Incidental Mutation 'R0392:Cyp2j7'
ID31753
Institutional Source Beutler Lab
Gene Symbol Cyp2j7
Ensembl Gene ENSMUSG00000081362
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 7
SynonymsCyp2j7-ps, OTTMUSG00000007941
MMRRC Submission 038598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0392 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location96195197-96236659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96199434 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000134331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162514]
Predicted Effect probably damaging
Transcript: ENSMUST00000162514
AA Change: D413G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134331
Gene: ENSMUSG00000081362
AA Change: D413G

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 499 3.7e-130 PFAM
Meta Mutation Damage Score 0.8968 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik T C 16: 4,977,499 noncoding transcript Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bcan T A 3: 87,993,562 K455* probably null Het
Casp12 T A 9: 5,348,973 probably benign Het
Ccdc61 T C 7: 18,891,102 M504V probably benign Het
Cd53 A T 3: 106,763,276 V147E probably damaging Het
Cyp2b13 T C 7: 26,085,883 Y226H probably benign Het
Dcbld1 T C 10: 52,317,134 I254T possibly damaging Het
Ddx39 T G 8: 83,721,737 M206R probably damaging Het
Dgki T A 6: 37,000,178 T666S probably damaging Het
Dnah7a C A 1: 53,504,198 C2271F probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Epha4 T C 1: 77,506,973 K133R probably benign Het
Gm11146 T A 16: 77,597,166 probably benign Het
Ift88 A T 14: 57,496,160 probably benign Het
Ighv10-3 A G 12: 114,523,840 probably benign Het
Lamp5 T C 2: 136,060,897 S179P probably damaging Het
Map4 T C 9: 110,078,045 S788P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,762 I279N possibly damaging Het
Otog T C 7: 46,250,075 W267R probably benign Het
Pafah1b2 T C 9: 45,968,853 I175M probably benign Het
Pcdhb12 A G 18: 37,436,958 K386E possibly damaging Het
Pcnt T C 10: 76,384,826 N2056S probably benign Het
Pold2 T C 11: 5,876,776 I53V possibly damaging Het
Rsf1 T A 7: 97,679,005 D1071E probably benign Het
Rtp3 A T 9: 110,989,553 M20K probably damaging Het
S1pr5 T A 9: 21,244,981 I50F probably damaging Het
Slc47a1 A G 11: 61,371,782 S94P probably damaging Het
Slitrk5 G A 14: 111,679,033 V30I probably benign Het
St8sia5 G A 18: 77,254,406 V271M probably damaging Het
Sult2b1 G T 7: 45,733,638 T240N probably damaging Het
Other mutations in Cyp2j7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Cyp2j7 APN 4 96227512 splice site probably benign
IGL00426:Cyp2j7 APN 4 96227513 splice site probably null
IGL01505:Cyp2j7 APN 4 96227680 critical splice acceptor site probably null
IGL02100:Cyp2j7 APN 4 96236556 missense probably damaging 0.99
IGL02183:Cyp2j7 APN 4 96230147 splice site probably benign
IGL02596:Cyp2j7 APN 4 96215422 missense possibly damaging 0.56
IGL02661:Cyp2j7 APN 4 96236650 missense probably benign
IGL02723:Cyp2j7 APN 4 96230129 missense probably benign 0.33
IGL03053:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03159:Cyp2j7 APN 4 96227512 splice site probably benign
IGL03168:Cyp2j7 APN 4 96230037 missense probably benign 0.00
IGL03174:Cyp2j7 APN 4 96195370 nonsense probably null
PIT4449001:Cyp2j7 UTSW 4 96215338 missense probably damaging 0.96
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R0016:Cyp2j7 UTSW 4 96202147 missense probably damaging 0.99
R1447:Cyp2j7 UTSW 4 96195293 missense possibly damaging 0.90
R1778:Cyp2j7 UTSW 4 96199390 missense probably damaging 1.00
R1876:Cyp2j7 UTSW 4 96217419 missense probably benign 0.01
R4105:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4106:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4107:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4108:Cyp2j7 UTSW 4 96199450 missense possibly damaging 0.84
R4438:Cyp2j7 UTSW 4 96217409 missense probably benign 0.01
R4660:Cyp2j7 UTSW 4 96195342 missense probably benign 0.29
R6193:Cyp2j7 UTSW 4 96195203 missense probably damaging 1.00
R6380:Cyp2j7 UTSW 4 96229974 critical splice donor site probably null
R6427:Cyp2j7 UTSW 4 96227667 missense probably damaging 0.96
R6624:Cyp2j7 UTSW 4 96227618 missense probably damaging 0.99
R7196:Cyp2j7 UTSW 4 96215414 missense probably benign 0.03
R7417:Cyp2j7 UTSW 4 96201988 critical splice donor site probably null
R7780:Cyp2j7 UTSW 4 96230019 missense probably benign 0.00
R8062:Cyp2j7 UTSW 4 96215350 missense probably null 1.00
R8097:Cyp2j7 UTSW 4 96215410 missense possibly damaging 0.95
R8201:Cyp2j7 UTSW 4 96195327 missense probably damaging 1.00
R8279:Cyp2j7 UTSW 4 96228559 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGCACTGGTCATGAAACAGCAC -3'
(R):5'- GAAATGCGCTAAGCAAACACTGTCC -3'

Sequencing Primer
(F):5'- TGAAACAGCACTATGGACATGC -3'
(R):5'- CTGTCCATCAATGATCTGAACAAGG -3'
Posted On2013-04-24