Incidental Mutation 'R4090:Carf'
ID317540
Institutional Source Beutler Lab
Gene Symbol Carf
Ensembl Gene ENSMUSG00000026017
Gene Namecalcium response factor
SynonymsAls2cr8
MMRRC Submission 040983-MU
Accession Numbers

Genbank: NM_139150; MGI: 2182269

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location60098247-60153953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60136347 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 245 (R245G)
Ref Sequence ENSEMBL: ENSMUSP00000027171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027171] [ENSMUST00000130075] [ENSMUST00000180952] [ENSMUST00000186107] [ENSMUST00000187978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027171
AA Change: R245G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027171
Gene: ENSMUSG00000026017
AA Change: R245G

DomainStartEndE-ValueType
Pfam:ALS2CR8 227 457 6.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130075
Predicted Effect probably benign
Transcript: ENSMUST00000180952
AA Change: R280G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000137825
Gene: ENSMUSG00000026017
AA Change: R280G

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186107
SMART Domains Protein: ENSMUSP00000139554
Gene: ENSMUSG00000026017

DomainStartEndE-ValueType
low complexity region 239 255 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186779
Predicted Effect probably benign
Transcript: ENSMUST00000187978
AA Change: R280G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141169
Gene: ENSMUSG00000026017
AA Change: R280G

DomainStartEndE-ValueType
Pfam:ALS2CR8 224 458 1.2e-64 PFAM
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have aberrant learning and memory. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Carf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Carf APN 1 60124842 splice site probably benign
IGL00730:Carf APN 1 60147418 nonsense probably null
IGL00792:Carf APN 1 60126009 missense possibly damaging 0.73
IGL00913:Carf APN 1 60147955 missense probably benign 0.20
IGL01487:Carf APN 1 60109379 missense probably damaging 1.00
IGL02214:Carf APN 1 60148081 missense probably damaging 1.00
IGL03258:Carf APN 1 60109229 missense possibly damaging 0.93
IGL03285:Carf APN 1 60146154 missense probably damaging 1.00
3-1:Carf UTSW 1 60141468 missense possibly damaging 0.93
PIT4283001:Carf UTSW 1 60128002 missense probably benign 0.32
R0375:Carf UTSW 1 60144002 missense probably damaging 1.00
R0465:Carf UTSW 1 60131983 missense probably damaging 1.00
R0591:Carf UTSW 1 60125914 splice site probably benign
R1158:Carf UTSW 1 60147839 missense probably benign 0.22
R1433:Carf UTSW 1 60124858 missense probably damaging 1.00
R1464:Carf UTSW 1 60125906 splice site probably benign
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1467:Carf UTSW 1 60127993 missense possibly damaging 0.58
R1546:Carf UTSW 1 60126036 critical splice donor site probably null
R1801:Carf UTSW 1 60141505 missense possibly damaging 0.60
R1977:Carf UTSW 1 60146136 missense probably damaging 1.00
R2086:Carf UTSW 1 60109411 missense probably damaging 1.00
R2163:Carf UTSW 1 60147486 splice site probably benign
R2198:Carf UTSW 1 60141484 missense probably damaging 1.00
R2238:Carf UTSW 1 60148034 missense probably benign
R2981:Carf UTSW 1 60139232 missense probably damaging 1.00
R4573:Carf UTSW 1 60148112 missense probably benign 0.39
R4737:Carf UTSW 1 60109318 missense probably benign 0.00
R4906:Carf UTSW 1 60141367 missense probably damaging 1.00
R4965:Carf UTSW 1 60150637 missense probably damaging 0.99
R5080:Carf UTSW 1 60150613 missense probably damaging 0.98
R5184:Carf UTSW 1 60108174 missense probably damaging 0.99
R5949:Carf UTSW 1 60139313 missense probably damaging 1.00
R6135:Carf UTSW 1 60147963 missense probably damaging 1.00
R6346:Carf UTSW 1 60141540 nonsense probably null
R6886:Carf UTSW 1 60136254 splice site probably null
R7115:Carf UTSW 1 60148150 missense probably damaging 1.00
R7228:Carf UTSW 1 60109394 missense probably damaging 0.99
R7459:Carf UTSW 1 60128039 missense possibly damaging 0.93
R7755:Carf UTSW 1 60148055 missense probably benign 0.00
R7809:Carf UTSW 1 60144067 missense probably damaging 0.98
R8053:Carf UTSW 1 60128038 missense probably benign 0.42
Z1177:Carf UTSW 1 60136262 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTACATTTTGACATTGTCACAGCC -3'
(R):5'- GAAGAGGATATGTGTGCATTCATG -3'

Sequencing Primer
(F):5'- GTCACAGCCACATTTTAAAAATCTG -3'
(R):5'- AAACCACTGGGATTTCAGGCTTC -3'
Posted On2015-05-15