Incidental Mutation 'R4090:Traf3ip3'
ID317545
Institutional Source Beutler Lab
Gene Symbol Traf3ip3
Ensembl Gene ENSMUSG00000037318
Gene NameTRAF3 interacting protein 3
Synonyms6030423D04Rik
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193175453-193201703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193181320 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 414 (V414A)
Ref Sequence ENSEMBL: ENSMUSP00000141698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043550] [ENSMUST00000159666] [ENSMUST00000160822] [ENSMUST00000178744] [ENSMUST00000192020] [ENSMUST00000194278]
Predicted Effect probably damaging
Transcript: ENSMUST00000043550
AA Change: V414A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040977
Gene: ENSMUSG00000037318
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159666
Predicted Effect unknown
Transcript: ENSMUST00000160302
AA Change: V116A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160332
Predicted Effect probably benign
Transcript: ENSMUST00000160822
SMART Domains Protein: ENSMUSP00000124546
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 15 263 2.7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161403
Predicted Effect probably benign
Transcript: ENSMUST00000162480
Predicted Effect probably benign
Transcript: ENSMUST00000178744
SMART Domains Protein: ENSMUSP00000136653
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192020
AA Change: V414A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141698
Gene: ENSMUSG00000037318
AA Change: V414A

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194278
SMART Domains Protein: ENSMUSP00000141661
Gene: ENSMUSG00000037318

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired single positive thymocyte development and increased gamma-delta T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Traf3ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Traf3ip3 APN 1 193194820 intron probably benign
IGL00663:Traf3ip3 APN 1 193187138 missense probably damaging 1.00
IGL01125:Traf3ip3 APN 1 193184464 splice site probably null
IGL01308:Traf3ip3 APN 1 193184891 missense probably damaging 1.00
IGL01608:Traf3ip3 APN 1 193187110 missense probably benign 0.00
IGL02225:Traf3ip3 APN 1 193195100 missense probably benign 0.03
IGL02432:Traf3ip3 APN 1 193184576 missense probably damaging 1.00
IGL03102:Traf3ip3 APN 1 193195077 missense probably damaging 1.00
IGL03179:Traf3ip3 APN 1 193194368 missense probably damaging 1.00
IGL02988:Traf3ip3 UTSW 1 193194874 unclassified probably null
R0110:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0469:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0510:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0529:Traf3ip3 UTSW 1 193194811 intron probably benign
R1165:Traf3ip3 UTSW 1 193184478 missense probably damaging 0.99
R1559:Traf3ip3 UTSW 1 193178291 missense probably damaging 0.99
R1729:Traf3ip3 UTSW 1 193181893 missense probably benign 0.01
R1896:Traf3ip3 UTSW 1 193175734 missense probably benign
R4085:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4086:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4087:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4088:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4258:Traf3ip3 UTSW 1 193197946 missense probably damaging 1.00
R4817:Traf3ip3 UTSW 1 193184829 missense probably damaging 1.00
R5299:Traf3ip3 UTSW 1 193178175 nonsense probably null
R5906:Traf3ip3 UTSW 1 193198006 missense possibly damaging 0.55
R6268:Traf3ip3 UTSW 1 193198036 start gained probably benign
R6374:Traf3ip3 UTSW 1 193182010 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGCAGATGATCCCTCAGC -3'
(R):5'- AAAGGACCCACTAGTGTGTG -3'

Sequencing Primer
(F):5'- GATGATCCCTCAGCCCAGC -3'
(R):5'- CCTGTGTGAATGCTGGCCTC -3'
Posted On2015-05-15