Incidental Mutation 'R4090:Rragd'
ID317550
Institutional Source Beutler Lab
Gene Symbol Rragd
Ensembl Gene ENSMUSG00000028278
Gene NameRas-related GTP binding D
SynonymsD4Ertd174e, C030003H22Rik, 5730543C08Rik
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32983037-33022180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33007155 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 161 (T161M)
Ref Sequence ENSEMBL: ENSMUSP00000081799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029946] [ENSMUST00000084747] [ENSMUST00000098190]
Predicted Effect probably damaging
Transcript: ENSMUST00000029946
AA Change: T336M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029946
Gene: ENSMUSG00000028278
AA Change: T336M

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:Arf 105 291 9.5e-9 PFAM
Pfam:SRPRB 114 220 1.2e-7 PFAM
Pfam:Gtr1_RagA 118 344 3.2e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084747
AA Change: T161M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081799
Gene: ENSMUSG00000028278
AA Change: T161M

DomainStartEndE-ValueType
Pfam:Gtr1_RagA 24 169 1.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098190
AA Change: T281M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095792
Gene: ENSMUSG00000028278
AA Change: T281M

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:Arf 51 236 8.2e-9 PFAM
Pfam:SRPRB 59 166 9.5e-8 PFAM
Pfam:Gtr1_RagA 63 289 9.9e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136792
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RRAGD is a monomeric guanine nucleotide-binding protein, or G protein. By binding GTP or GDP, small G proteins act as molecular switches in numerous cell processes and signaling pathways.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Rragd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Rragd APN 4 33007219 splice site probably benign
R0432:Rragd UTSW 4 33004332 missense probably damaging 0.98
R0542:Rragd UTSW 4 33007103 missense probably damaging 1.00
R1521:Rragd UTSW 4 32996005 missense probably damaging 0.96
R4272:Rragd UTSW 4 32996099 critical splice donor site probably null
R4812:Rragd UTSW 4 33018766 missense probably benign 0.11
R4817:Rragd UTSW 4 32995072 missense probably benign
R6235:Rragd UTSW 4 32995985 missense possibly damaging 0.78
R7124:Rragd UTSW 4 32996027 missense possibly damaging 0.83
R7532:Rragd UTSW 4 33004166 missense possibly damaging 0.72
R7640:Rragd UTSW 4 32983527 missense probably benign 0.09
RF040:Rragd UTSW 4 32995150 intron probably benign
RF061:Rragd UTSW 4 32995150 intron probably benign
Z1177:Rragd UTSW 4 33005141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGCTGTTACTTTGAGGC -3'
(R):5'- TGGCAGGTGGTCATTCTAACC -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
(R):5'- AGGTGGTCATTCTAACCTCACC -3'
Posted On2015-05-15