Incidental Mutation 'R4090:Mlxipl'
ID317559
Institutional Source Beutler Lab
Gene Symbol Mlxipl
Ensembl Gene ENSMUSG00000005373
Gene NameMLX interacting protein-like
SynonymsWS-bHLH, Wbscr14, bHLHd14, ChREBP
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135089890-135138382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135132527 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 433 (E433D)
Ref Sequence ENSEMBL: ENSMUSP00000122198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]
PDB Structure
Complex of ChREBP and 14-3-3beta [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005507
AA Change: E433D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: E433D

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 1e-8 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
HLH 667 721 1.14e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123370
SMART Domains Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 19 73 1.14e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128691
AA Change: E433D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373
AA Change: E433D

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1hloa_ 658 709 6e-7 SMART
Blast:HLH 667 699 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129008
AA Change: E433D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373
AA Change: E433D

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142385
AA Change: E433D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373
AA Change: E433D

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 7e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153519
AA Change: E433D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373
AA Change: E433D

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PDB:4GNT|B 117 137 9e-9 PDB
low complexity region 261 271 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
low complexity region 414 437 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
low complexity region 513 531 N/A INTRINSIC
low complexity region 574 603 N/A INTRINSIC
SCOP:d1am9a_ 658 696 1e-5 SMART
Blast:HLH 667 698 2e-12 BLAST
low complexity region 728 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154840
SMART Domains Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

DomainStartEndE-ValueType
HLH 26 120 7.9e-4 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Mlxipl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Mlxipl APN 5 135132778 missense probably damaging 0.98
IGL01872:Mlxipl APN 5 135113691 missense probably damaging 1.00
IGL02694:Mlxipl APN 5 135124018 critical splice donor site probably null
IGL03070:Mlxipl APN 5 135132453 missense possibly damaging 0.93
Scarlet UTSW 5 135134030 missense possibly damaging 0.93
H8441:Mlxipl UTSW 5 135123961 missense probably damaging 1.00
IGL03054:Mlxipl UTSW 5 135133256 missense possibly damaging 0.83
R0003:Mlxipl UTSW 5 135133189 unclassified probably benign
R0126:Mlxipl UTSW 5 135132323 missense probably damaging 0.96
R0458:Mlxipl UTSW 5 135133370 missense probably benign 0.33
R0513:Mlxipl UTSW 5 135137263 missense probably benign 0.33
R0580:Mlxipl UTSW 5 135123975 missense probably benign 0.01
R0744:Mlxipl UTSW 5 135132475 missense possibly damaging 0.86
R0827:Mlxipl UTSW 5 135132738 missense probably benign 0.00
R1052:Mlxipl UTSW 5 135113710 missense probably damaging 1.00
R1241:Mlxipl UTSW 5 135132718 missense probably benign 0.01
R1795:Mlxipl UTSW 5 135107170 missense probably damaging 1.00
R1903:Mlxipl UTSW 5 135133568 missense possibly damaging 0.92
R2038:Mlxipl UTSW 5 135106999 missense probably damaging 1.00
R2064:Mlxipl UTSW 5 135132777 missense possibly damaging 0.77
R2069:Mlxipl UTSW 5 135107005 missense probably damaging 1.00
R2081:Mlxipl UTSW 5 135113638 missense probably damaging 1.00
R2095:Mlxipl UTSW 5 135122120 splice site probably benign
R3114:Mlxipl UTSW 5 135133662 splice site probably benign
R4018:Mlxipl UTSW 5 135132672 missense probably damaging 1.00
R4321:Mlxipl UTSW 5 135135450 nonsense probably null
R4414:Mlxipl UTSW 5 135137399 unclassified probably benign
R5706:Mlxipl UTSW 5 135133604 missense probably benign 0.33
R6088:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R6508:Mlxipl UTSW 5 135128620 missense probably benign 0.03
R6704:Mlxipl UTSW 5 135137240 critical splice acceptor site probably null
R7060:Mlxipl UTSW 5 135132315 missense possibly damaging 0.88
R7095:Mlxipl UTSW 5 135134030 missense possibly damaging 0.93
R7128:Mlxipl UTSW 5 135133851 missense probably damaging 0.98
R7464:Mlxipl UTSW 5 135133628 missense probably benign 0.01
R7510:Mlxipl UTSW 5 135133118 missense possibly damaging 0.72
R7669:Mlxipl UTSW 5 135132370 missense possibly damaging 0.53
R7737:Mlxipl UTSW 5 135135381 missense possibly damaging 0.73
R7806:Mlxipl UTSW 5 135134543 missense possibly damaging 0.93
R7910:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
R7991:Mlxipl UTSW 5 135132409 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TAGTTGCAAGAAGGTGGCTCC -3'
(R):5'- TACCCTGAGGCACAGTGAAG -3'

Sequencing Primer
(F):5'- AAGAAGGTGGCTCCATCCC -3'
(R):5'- CACAGTGAAGTGAGGCCC -3'
Posted On2015-05-15