Incidental Mutation 'R0392:Cyp2b13'
ID31756
Institutional Source Beutler Lab
Gene Symbol Cyp2b13
Ensembl Gene ENSMUSG00000040583
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 13
Synonymsphenobarbital inducible, type c
MMRRC Submission 038598-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0392 (G1)
Quality Score182
Status Validated
Chromosome7
Chromosomal Location26061497-26096197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26085883 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 226 (Y226H)
Ref Sequence ENSEMBL: ENSMUSP00000005669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005669]
Predicted Effect probably benign
Transcript: ENSMUST00000005669
AA Change: Y226H

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000005669
Gene: ENSMUSG00000040583
AA Change: Y226H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 9.8e-150 PFAM
Meta Mutation Damage Score 0.1178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik T C 16: 4,977,499 noncoding transcript Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bcan T A 3: 87,993,562 K455* probably null Het
Casp12 T A 9: 5,348,973 probably benign Het
Ccdc61 T C 7: 18,891,102 M504V probably benign Het
Cd53 A T 3: 106,763,276 V147E probably damaging Het
Cyp2j7 T C 4: 96,199,434 D413G probably damaging Het
Dcbld1 T C 10: 52,317,134 I254T possibly damaging Het
Ddx39 T G 8: 83,721,737 M206R probably damaging Het
Dgki T A 6: 37,000,178 T666S probably damaging Het
Dnah7a C A 1: 53,504,198 C2271F probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Epha4 T C 1: 77,506,973 K133R probably benign Het
Gm11146 T A 16: 77,597,166 probably benign Het
Ift88 A T 14: 57,496,160 probably benign Het
Ighv10-3 A G 12: 114,523,840 probably benign Het
Lamp5 T C 2: 136,060,897 S179P probably damaging Het
Map4 T C 9: 110,078,045 S788P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,762 I279N possibly damaging Het
Otog T C 7: 46,250,075 W267R probably benign Het
Pafah1b2 T C 9: 45,968,853 I175M probably benign Het
Pcdhb12 A G 18: 37,436,958 K386E possibly damaging Het
Pcnt T C 10: 76,384,826 N2056S probably benign Het
Pold2 T C 11: 5,876,776 I53V possibly damaging Het
Rsf1 T A 7: 97,679,005 D1071E probably benign Het
Rtp3 A T 9: 110,989,553 M20K probably damaging Het
S1pr5 T A 9: 21,244,981 I50F probably damaging Het
Slc47a1 A G 11: 61,371,782 S94P probably damaging Het
Slitrk5 G A 14: 111,679,033 V30I probably benign Het
St8sia5 G A 18: 77,254,406 V271M probably damaging Het
Sult2b1 G T 7: 45,733,638 T240N probably damaging Het
Other mutations in Cyp2b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cyp2b13 APN 7 26081727 missense probably benign 0.26
IGL01134:Cyp2b13 APN 7 26081700 missense probably damaging 1.00
IGL02386:Cyp2b13 APN 7 26086013 missense probably damaging 1.00
IGL02531:Cyp2b13 APN 7 26061605 missense possibly damaging 0.55
IGL02960:Cyp2b13 APN 7 26061676 missense probably benign 0.33
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0103:Cyp2b13 UTSW 7 26088710 missense probably damaging 1.00
R0121:Cyp2b13 UTSW 7 26086585 missense probably benign
R0540:Cyp2b13 UTSW 7 26081711 missense probably benign 0.07
R1887:Cyp2b13 UTSW 7 26088650 missense probably damaging 1.00
R2416:Cyp2b13 UTSW 7 26095821 makesense probably null
R2879:Cyp2b13 UTSW 7 26086031 critical splice donor site probably null
R4654:Cyp2b13 UTSW 7 26061647 missense probably damaging 1.00
R4735:Cyp2b13 UTSW 7 26088295 missense probably benign
R4969:Cyp2b13 UTSW 7 26080988 missense probably damaging 0.98
R5174:Cyp2b13 UTSW 7 26088693 missense possibly damaging 0.68
R6243:Cyp2b13 UTSW 7 26061619 missense probably damaging 1.00
R6616:Cyp2b13 UTSW 7 26085881 missense probably benign 0.04
R6647:Cyp2b13 UTSW 7 26085899 missense possibly damaging 0.52
R6766:Cyp2b13 UTSW 7 26081811 critical splice donor site probably null
R6844:Cyp2b13 UTSW 7 26081697 missense probably damaging 1.00
R7431:Cyp2b13 UTSW 7 26061551 missense probably damaging 0.96
R7593:Cyp2b13 UTSW 7 26080991 missense possibly damaging 0.64
R7719:Cyp2b13 UTSW 7 26095670 missense probably damaging 1.00
R7857:Cyp2b13 UTSW 7 26088728 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAAGTTGTTGGGACAGCTAGACTAGG -3'
(R):5'- GCCTCTCTCATCCATGCAGGATTAACC -3'

Sequencing Primer
(F):5'- tctccattgttcttcctgcc -3'
(R):5'- ATCCATGCAGGATTAACCTTCTC -3'
Posted On2013-04-24