Incidental Mutation 'R4090:Gkn3'
ID317563
Institutional Source Beutler Lab
Gene Symbol Gkn3
Ensembl Gene ENSMUSG00000030048
Gene Namegastrokine 3
Synonyms
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4090 (G1)
Quality Score154
Status Validated
Chromosome6
Chromosomal Location87383256-87388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87383525 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000032127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032127] [ENSMUST00000032128]
Predicted Effect probably damaging
Transcript: ENSMUST00000032127
AA Change: A163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032127
Gene: ENSMUSG00000030048
AA Change: A163T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BRICHOS 63 155 1.47e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032128
SMART Domains Protein: ENSMUSP00000032128
Gene: ENSMUSG00000030049

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BRICHOS 54 151 6.63e-34 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Gkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Gkn3 APN 6 87383511 missense possibly damaging 0.70
IGL02746:Gkn3 APN 6 87387357 splice site probably benign
IGL03345:Gkn3 APN 6 87388816 missense probably null 0.09
R1758:Gkn3 UTSW 6 87388835 start codon destroyed probably benign
R2303:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2304:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2363:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2365:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2897:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2898:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2983:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3031:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3426:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3433:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4085:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4086:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4087:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4088:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4089:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4164:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4720:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4721:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4722:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4723:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4766:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4941:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5004:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6078:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6079:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6502:Gkn3 UTSW 6 87388804 missense probably benign 0.01
R6924:Gkn3 UTSW 6 87388802 missense probably benign 0.05
R7695:Gkn3 UTSW 6 87384440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGGGAAGCCAACATGTG -3'
(R):5'- GTTCTTCAAGACACAAGGGTCCC -3'

Sequencing Primer
(F):5'- TGTGGAGCACAGAGGACTGC -3'
(R):5'- CACACTGGGCTAAGGGGTTAC -3'
Posted On2015-05-15