Incidental Mutation 'R4090:Olfr829'
ID317567
Institutional Source Beutler Lab
Gene Symbol Olfr829
Ensembl Gene ENSMUSG00000051414
Gene Nameolfactory receptor 829
SynonymsGA_x6K02T2PVTD-12599710-12600648, MOR147-1
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18854933-18859080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18857102 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 159 (I159T)
Ref Sequence ENSEMBL: ENSMUSP00000058101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058411] [ENSMUST00000212229]
Predicted Effect probably benign
Transcript: ENSMUST00000058411
AA Change: I159T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058101
Gene: ENSMUSG00000051414
AA Change: I159T

DomainStartEndE-ValueType
Pfam:7tm_4 40 317 2e-52 PFAM
Pfam:7TM_GPCR_Srsx 44 174 1e-10 PFAM
Pfam:7tm_1 50 299 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212229
AA Change: I150T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Olfr829
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr829 APN 9 18857534 missense probably damaging 0.97
IGL01696:Olfr829 APN 9 18857056 missense probably benign 0.19
IGL02285:Olfr829 APN 9 18856990 missense possibly damaging 0.87
R0133:Olfr829 UTSW 9 18856629 start codon destroyed probably null
R0173:Olfr829 UTSW 9 18857029 missense probably damaging 0.98
R0270:Olfr829 UTSW 9 18856831 missense probably damaging 1.00
R0449:Olfr829 UTSW 9 18856649 missense probably benign 0.00
R1111:Olfr829 UTSW 9 18857592 makesense probably null
R1462:Olfr829 UTSW 9 18857111 missense probably benign 0.30
R1462:Olfr829 UTSW 9 18857111 missense probably benign 0.30
R1845:Olfr829 UTSW 9 18857486 missense possibly damaging 0.95
R4096:Olfr829 UTSW 9 18856637 missense probably benign
R4097:Olfr829 UTSW 9 18856637 missense probably benign
R4755:Olfr829 UTSW 9 18857180 missense probably benign 0.03
R4867:Olfr829 UTSW 9 18857566 missense probably benign 0.00
R5084:Olfr829 UTSW 9 18857336 missense probably benign 0.43
R7216:Olfr829 UTSW 9 18857336 missense probably benign 0.43
R7252:Olfr829 UTSW 9 18857252 missense probably damaging 1.00
R7300:Olfr829 UTSW 9 18857234 missense not run
R7412:Olfr829 UTSW 9 18856789 missense possibly damaging 0.51
X0024:Olfr829 UTSW 9 18857024 missense probably damaging 1.00
X0057:Olfr829 UTSW 9 18856637 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGGATGTCTGACTCAGG -3'
(R):5'- TCTCAAGACAGTGGTTGCAATTTG -3'

Sequencing Primer
(F):5'- AGGATGTCTGACTCAGGTCTGC -3'
(R):5'- GACAGTGGTTGCAATTTGACAATATG -3'
Posted On2015-05-15