Incidental Mutation 'R4090:Slurp1'
ID317580
Institutional Source Beutler Lab
Gene Symbol Slurp1
Ensembl Gene ENSMUSG00000022596
Gene Namesecreted Ly6/Plaur domain containing 1
SynonymsARS component B, 1110021N19Rik
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74724318-74728034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74726875 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 89 (H89R)
Ref Sequence ENSEMBL: ENSMUSP00000141013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023261] [ENSMUST00000070923] [ENSMUST00000190433]
Predicted Effect probably benign
Transcript: ENSMUST00000023261
SMART Domains Protein: ENSMUSP00000023261
Gene: ENSMUSG00000022596

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LU 23 109 6.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070923
SMART Domains Protein: ENSMUSP00000069692
Gene: ENSMUSG00000056665

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:4HBT_2 54 185 5.8e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190433
AA Change: H89R

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141013
Gene: ENSMUSG00000022596
AA Change: H89R

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
LU 23 109 6.93e-2 SMART
Meta Mutation Damage Score 0.1620 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop palmoplantar keratoderma, decreased body weight, and neuromuscular and metabolic phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Slurp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0759:Slurp1 UTSW 15 74726959 missense probably damaging 0.97
R3919:Slurp1 UTSW 15 74726810 makesense probably null
R4031:Slurp1 UTSW 15 74727487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAGTGAGTGACCTGAG -3'
(R):5'- TTGGGCAGATTTAAGATGCAGG -3'

Sequencing Primer
(F):5'- AGTGACCTGAGGCTCAGTG -3'
(R):5'- TTGCAGGAGGGGTTTGAGAAG -3'
Posted On2015-05-15