Incidental Mutation 'R4090:Npc1'
ID317583
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 12198162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025279]
Predicted Effect probably null
Transcript: ENSMUST00000025279
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153352
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1804:Npc1 UTSW 18 12223088 missense probably damaging 1.00
R1808:Npc1 UTSW 18 12194092 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2311:Npc1 UTSW 18 12202183 missense probably benign
R2446:Npc1 UTSW 18 12214339 missense probably benign 0.01
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6080:Npc1 UTSW 18 12219351 missense probably damaging 1.00
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7007:Npc1 UTSW 18 12210548 missense probably benign 0.02
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AACTAGGTGTCCAGCTCAGC -3'
(R):5'- GTGAACGCAGAACTCTTCATG -3'

Sequencing Primer
(F):5'- CGTTAAATATCTGCTGCACCAGGG -3'
(R):5'- GTGAACGCAGAACTCTTCATGATGTC -3'
Posted On2015-05-15