Incidental Mutation 'R4090:Pcdha3'
ID317584
Institutional Source Beutler Lab
Gene Symbol Pcdha3
Ensembl Gene ENSMUSG00000102312
Gene Nameprotocadherin alpha 3
Synonyms
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36946105-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36948451 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 749 (R749G)
Ref Sequence ENSEMBL: ENSMUSP00000141989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115661] [ENSMUST00000115662] [ENSMUST00000192295] [ENSMUST00000192503] [ENSMUST00000192512] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192503
AA Change: R749G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312
AA Change: R749G

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194235
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Meta Mutation Damage Score 0.3701 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Exoc6 A G 19: 37,571,912 T126A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Pcdha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2497:Pcdha3 UTSW 18 36947503 missense probably benign
R3702:Pcdha3 UTSW 18 36947348 missense probably benign 0.16
R4273:Pcdha3 UTSW 18 36948091 missense probably damaging 1.00
R4486:Pcdha3 UTSW 18 36947351 missense probably damaging 1.00
R4535:Pcdha3 UTSW 18 36947960 missense probably damaging 1.00
R4582:Pcdha3 UTSW 18 36947432 missense probably benign
R4712:Pcdha3 UTSW 18 36946507 missense probably damaging 1.00
R5160:Pcdha3 UTSW 18 36946427 missense probably damaging 1.00
R5302:Pcdha3 UTSW 18 36948155 missense probably damaging 0.96
R5361:Pcdha3 UTSW 18 36946699 missense possibly damaging 0.80
R5535:Pcdha3 UTSW 18 36947936 missense probably benign 0.02
R5682:Pcdha3 UTSW 18 36947987 missense probably damaging 0.99
R6656:Pcdha3 UTSW 18 36947822 missense probably benign 0.24
R6878:Pcdha3 UTSW 18 36947363 nonsense probably null
R7150:Pcdha3 UTSW 18 36947112 missense probably benign 0.01
R7167:Pcdha3 UTSW 18 36946993 missense probably damaging 1.00
R7299:Pcdha3 UTSW 18 36946924 missense possibly damaging 0.56
R7301:Pcdha3 UTSW 18 36946924 missense possibly damaging 0.56
R7448:Pcdha3 UTSW 18 36946213 missense probably benign 0.00
R7467:Pcdha3 UTSW 18 36947531 missense probably damaging 1.00
R7542:Pcdha3 UTSW 18 36947731 missense possibly damaging 0.86
R7659:Pcdha3 UTSW 18 36948166 missense probably benign 0.14
R7761:Pcdha3 UTSW 18 36946294 missense probably damaging 1.00
R7782:Pcdha3 UTSW 18 36948140 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACCTGATCATCGCCATCTGTG -3'
(R):5'- TAGCGAGTGTAAAGTTCTCTACAG -3'

Sequencing Primer
(F):5'- GCCATCTGTGCCGTGTCTAG -3'
(R):5'- GAATAGTTCATTTTAACGCCATCTCC -3'
Posted On2015-05-15