Incidental Mutation 'R4090:Exoc6'
ID317585
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Nameexocyst complex component 6
Synonymsmsec15, Sec15l1, 4833405E05Rik, Sec15, hbd
MMRRC Submission 040983-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4090 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37550418-37683245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37571912 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 126 (T126A)
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
Predicted Effect probably benign
Transcript: ENSMUST00000066439
AA Change: T126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: T126A

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,212,358 probably null Het
Acss3 T G 10: 107,053,452 Y169S probably damaging Het
Apc2 A G 10: 80,305,544 K268E probably damaging Het
Arhgef2 G C 3: 88,643,878 R765P probably benign Het
Bptf T C 11: 107,081,523 K840E probably damaging Het
Carf A G 1: 60,136,347 R245G possibly damaging Het
Cd36 A G 5: 17,785,720 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Fam83f A T 15: 80,692,192 N348I possibly damaging Het
Gja8 A G 3: 96,919,152 V398A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm12789 A T 4: 101,988,329 T72S possibly damaging Het
Gm1988 A G 7: 39,170,868 noncoding transcript Het
Gm21370 A G 13: 120,026,953 V20A probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Hsd17b13 T A 5: 103,965,854 S245C probably benign Het
Htr1f T C 16: 64,925,961 K323E probably benign Het
Igkc T C 6: 70,726,458 probably benign Het
Ksr1 T C 11: 79,027,477 E535G probably damaging Het
Mlxipl A T 5: 135,132,527 E433D probably benign Het
Npc1 T C 18: 12,198,162 probably null Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr220 A G 1: 174,448,934 T104A probably benign Het
Olfr389 A G 11: 73,776,841 L162P probably damaging Het
Olfr829 T C 9: 18,857,102 I159T probably benign Het
Pcdha3 A G 18: 36,948,451 R749G probably benign Het
Ppme1 A T 7: 100,347,837 N122K possibly damaging Het
Rasal1 G A 5: 120,675,609 V657M possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Rragd C T 4: 33,007,155 T161M probably damaging Het
Slurp1 T C 15: 74,726,875 H89R possibly damaging Het
Snap23 A G 2: 120,585,580 I42V probably benign Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar8a T A 10: 24,077,164 V222E probably damaging Het
Tmem171 A T 13: 98,692,588 V18D probably damaging Het
Topors T C 4: 40,260,794 D830G unknown Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Tubg1 T A 11: 101,124,538 M270K possibly damaging Het
Vmn1r188 T C 13: 22,088,602 V242A probably benign Het
Vmn1r19 T A 6: 57,404,735 I91N probably damaging Het
Vmn2r12 T A 5: 109,091,546 M384L probably benign Het
Wdr26 T C 1: 181,203,114 E205G probably damaging Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp398 T A 6: 47,866,225 C272S probably damaging Het
Zfp975 A G 7: 42,662,874 V105A probably benign Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37589876 missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37682964 missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37608954 missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37578474 missense probably benign
IGL03394:Exoc6 APN 19 37599572 missense probably benign 0.15
australamerican UTSW 19 37598679 critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37593769 critical splice donor site probably null
R1156:Exoc6 UTSW 19 37682897 missense probably benign 0.05
R1489:Exoc6 UTSW 19 37597120 missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37639769 splice site probably null
R2125:Exoc6 UTSW 19 37590941 missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37653413 missense probably benign 0.34
R4666:Exoc6 UTSW 19 37570505 missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37609082 missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37598679 critical splice donor site probably null
R5471:Exoc6 UTSW 19 37599617 missense probably benign 0.30
R5533:Exoc6 UTSW 19 37593770 splice site probably null
R5607:Exoc6 UTSW 19 37578529 missense probably benign 0.01
R5641:Exoc6 UTSW 19 37587633 splice site probably null
R5759:Exoc6 UTSW 19 37573741 nonsense probably null
R5889:Exoc6 UTSW 19 37582245 missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37571912 missense probably benign
R6936:Exoc6 UTSW 19 37571863 missense probably benign 0.00
R6988:Exoc6 UTSW 19 37609091 missense probably damaging 1.00
R7088:Exoc6 UTSW 19 37577010 missense probably damaging 0.99
R7162:Exoc6 UTSW 19 37577118 missense probably damaging 0.97
R7948:Exoc6 UTSW 19 37576974 missense probably benign 0.00
RF009:Exoc6 UTSW 19 37571620 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGTTACCGATACCAACC -3'
(R):5'- AACCTGGGAACACTCACTTC -3'

Sequencing Primer
(F):5'- CGAAGGTTTCAAGATGCAGG -3'
(R):5'- GGAACACTCACTTCTTAAAACTCGTG -3'
Posted On2015-05-15