Incidental Mutation 'R4091:Kynu'
ID317592
Institutional Source Beutler Lab
Gene Symbol Kynu
Ensembl Gene ENSMUSG00000026866
Gene Namekynureninase (L-kynurenine hydrolase)
Synonyms
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4091 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location43555329-43682715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43679872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 389 (V389M)
Ref Sequence ENSEMBL: ENSMUSP00000108445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028223] [ENSMUST00000112826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028223
AA Change: V389M

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028223
Gene: ENSMUSG00000026866
AA Change: V389M

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 400 3.8e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112826
AA Change: V389M

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108445
Gene: ENSMUSG00000026866
AA Change: V389M

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 405 8.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148855
Meta Mutation Damage Score 0.3713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Kynu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Kynu APN 2 43671382 missense possibly damaging 0.91
IGL01974:Kynu APN 2 43681340 unclassified probably benign
R0099:Kynu UTSW 2 43629053 critical splice donor site probably null
R0304:Kynu UTSW 2 43679881 missense probably damaging 0.99
R1681:Kynu UTSW 2 43679825 missense probably damaging 1.00
R1799:Kynu UTSW 2 43604157 missense possibly damaging 0.65
R2016:Kynu UTSW 2 43604277 nonsense probably null
R2345:Kynu UTSW 2 43581385 missense probably damaging 1.00
R3085:Kynu UTSW 2 43602300 missense probably benign 0.00
R3825:Kynu UTSW 2 43681439 missense probably benign
R4241:Kynu UTSW 2 43681410 missense probably benign 0.00
R4594:Kynu UTSW 2 43679890 missense probably benign 0.00
R4673:Kynu UTSW 2 43679803 missense probably damaging 1.00
R4871:Kynu UTSW 2 43679818 missense possibly damaging 0.58
R5371:Kynu UTSW 2 43589394 missense probably benign 0.00
R6272:Kynu UTSW 2 43634989 missense probably benign 0.01
R6342:Kynu UTSW 2 43681451 missense probably benign 0.09
R6866:Kynu UTSW 2 43563110 nonsense probably null
R7203:Kynu UTSW 2 43681353 missense probably damaging 1.00
R8163:Kynu UTSW 2 43628954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCTTCTCTGTAAATCAGTAGCC -3'
(R):5'- ACGCTGAGTGCTAAGTTGATG -3'

Sequencing Primer
(F):5'- GCCACTGCTAATCTGATTGTGAC -3'
(R):5'- AGTTTAGTAACCTAAGACTCATCCC -3'
Posted On2015-05-15