Mutagenetix > Incidental Mutations

Incidental Mutation 'R4091:Rxfp1'

317596

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

041626-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.255) question?

Stock #

R4091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79644761 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 744 (D744E)

Ref Sequence

ENSEMBL: ENSMUSP00000077611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

Predicted Effect

probably benign
Transcript: ENSMUST00000078527
AA Change: D744E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: D744E

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182491

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,745,378	S674P	possibly damaging	Het
4932438A13Rik	G	A	3: 37,030,589	A3897T	probably benign	Het
A530099J19Rik	T	A	13: 19,729,465		noncoding transcript	Het
Abca3	C	T	17: 24,397,482	T966M	probably damaging	Het
Adam2	A	T	14: 66,029,723	Y696N	probably damaging	Het
Aes	G	A	10: 81,565,584	G162D	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap25	G	T	6: 87,463,035	S543R	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Carns1	C	T	19: 4,171,683	R191Q	probably damaging	Het
Casp8ap2	C	A	4: 32,643,611	P895T	probably damaging	Het
Col12a1	T	A	9: 79,702,364	I287F	probably damaging	Het
Cystm1	A	G	18: 36,366,547	N5S	unknown	Het
Dnah8	T	C	17: 30,769,839	V3261A	probably damaging	Het
Dnajc11	A	G	4: 151,978,093		probably benign	Het
Dock4	T	C	12: 40,844,267	S1847P	probably damaging	Het
Dync2h1	A	G	9: 7,131,881	V1642A	probably benign	Het
Eftud2	T	C	11: 102,839,416		probably null	Het
Fam221b	A	G	4: 43,665,987	I208T	probably benign	Het
Gpr37l1	T	C	1: 135,161,563	I255V	probably benign	Het
Grm7	G	A	6: 110,914,340	S178N	probably damaging	Het
Hspa12b	T	A	2: 131,133,488		probably null	Het
Kctd3	A	T	1: 188,995,720		probably benign	Het
Kynu	G	A	2: 43,679,872	V389M	possibly damaging	Het
Lcat	A	G	8: 105,939,906	L328P	probably benign	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Maml1	G	A	11: 50,291,829	P78L	probably benign	Het
Mef2b	G	A	8: 70,165,102	V37M	probably damaging	Het
Mindy2	A	T	9: 70,634,060	M281K	probably damaging	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Mtr	A	T	13: 12,231,057	V394E	probably damaging	Het
Myh14	T	A	7: 44,632,991	T745S	possibly damaging	Het
Nme9	T	A	9: 99,464,527	D131E	possibly damaging	Het
Nphp4	C	A	4: 152,547,018	Q792K	probably damaging	Het
Nrxn2	T	A	19: 6,473,414	C479S	probably damaging	Het
Nsmf	T	C	2: 25,060,859	I406T	probably damaging	Het
Olfr1431	A	T	19: 12,209,779	D71V	probably damaging	Het
Olfr517	G	A	7: 108,868,443	A237V	probably damaging	Het
Olfr945	T	A	9: 39,258,034	I213F	possibly damaging	Het
Pbrm1	A	G	14: 31,036,003	T197A	probably benign	Het
Pla2r1	T	A	2: 60,432,593	N1034I	probably damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samd9l	T	C	6: 3,376,887	N125D	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Slc22a30	C	T	19: 8,404,545	V121M	probably damaging	Het
Smarcc1	T	A	9: 110,164,829	D247E	possibly damaging	Het
Smg9	T	A	7: 24,420,867	L422Q	probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Utrn	T	A	10: 12,710,171	D954V	probably benign	Het
Vmn1r227	T	A	17: 20,735,516		noncoding transcript	Het
Vmn2r11	A	C	5: 109,054,750		probably null	Het
Vmn2r84	A	T	10: 130,391,369	M200K	probably damaging	Het
Vmn2r88	T	A	14: 51,415,426	Y469N	probably damaging	Het
Wdcp	A	G	12: 4,855,279	N600S	probably null	Het
Wdfy4	T	G	14: 33,125,880	R838S	possibly damaging	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1756:Rxfp1	UTSW	3	79670881	missense	probably benign	0.11
R1803:Rxfp1	UTSW	3	79737769	missense	probably benign
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4447:Rxfp1	UTSW	3	79652127	intron	probably benign
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79705668	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79663313	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7530:Rxfp1	UTSW	3	79650461	missense	probably benign	0.18
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
R7951:Rxfp1	UTSW	3	79652375	missense	probably damaging	1.00
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAACACCAGCTACCTGTCC -3'
(R):5'- ATTCTGCCTATCAACAGTGCTTTG -3'

Sequencing Primer
(F):5'- CCTACCTTGGGCCACTCTAAG -3'
(R):5'- CGTTGACCACTAGACCTTTCAAG -3'

Posted On

2015-05-15