Incidental Mutation 'R4091:Rxfp1'
ID317596
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Namerelaxin/insulin-like family peptide receptor 1
SynonymsLgr7, LOC381489
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4091 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79641611-79737880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79644761 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 744 (D744E)
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
Predicted Effect probably benign
Transcript: ENSMUST00000078527
AA Change: D744E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: D744E

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79652216 missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79686868 missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79660078 missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79660096 missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79650492 missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79660120 missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79652167 critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79670846 critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79652226 missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79667683 missense probably benign 0.29
juggler UTSW 3 79650591 nonsense probably null
R0123:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79644975 missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79682535 missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79667654 missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79737793 start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79652377 missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79650731 missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79705569 splice site probably null
R0627:Rxfp1 UTSW 3 79648211 missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79663293 splice site probably null
R1309:Rxfp1 UTSW 3 79663292 splice site probably null
R1756:Rxfp1 UTSW 3 79670881 missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79737769 missense probably benign
R2415:Rxfp1 UTSW 3 79663319 missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79682471 missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79644949 missense probably damaging 0.99
R4250:Rxfp1 UTSW 3 79652272 missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79686798 critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79652127 intron probably benign
R4607:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79705668 missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79686868 missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79650582 missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79644802 missense probably benign
R5059:Rxfp1 UTSW 3 79663312 missense probably benign
R5131:Rxfp1 UTSW 3 79652164 splice site probably null
R5641:Rxfp1 UTSW 3 79686892 missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79678747 missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79661320 missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79663313 missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79667848 missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79648289 missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79650591 nonsense probably null
R7059:Rxfp1 UTSW 3 79652269 missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79650461 missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79648090 missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79670907 missense possibly damaging 0.66
Z1088:Rxfp1 UTSW 3 79705704 missense probably damaging 1.00
Z1177:Rxfp1 UTSW 3 79652367 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAACACCAGCTACCTGTCC -3'
(R):5'- ATTCTGCCTATCAACAGTGCTTTG -3'

Sequencing Primer
(F):5'- CCTACCTTGGGCCACTCTAAG -3'
(R):5'- CGTTGACCACTAGACCTTTCAAG -3'
Posted On2015-05-15