Mutagenetix > Incidental Mutations

Incidental Mutation 'R4091:Casp8ap2'

317597

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

041626-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32643611 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 895 (P895T)

Ref Sequence

ENSEMBL: ENSMUSP00000136016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000029950
AA Change: P895T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: P895T

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000108178

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127619

Predicted Effect

probably damaging
Transcript: ENSMUST00000178925
AA Change: P895T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: P895T

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Meta Mutation Damage Score

0.0925

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,745,378	S674P	possibly damaging	Het
4932438A13Rik	G	A	3: 37,030,589	A3897T	probably benign	Het
A530099J19Rik	T	A	13: 19,729,465		noncoding transcript	Het
Abca3	C	T	17: 24,397,482	T966M	probably damaging	Het
Adam2	A	T	14: 66,029,723	Y696N	probably damaging	Het
Aes	G	A	10: 81,565,584	G162D	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap25	G	T	6: 87,463,035	S543R	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Carns1	C	T	19: 4,171,683	R191Q	probably damaging	Het
Col12a1	T	A	9: 79,702,364	I287F	probably damaging	Het
Cystm1	A	G	18: 36,366,547	N5S	unknown	Het
Dnah8	T	C	17: 30,769,839	V3261A	probably damaging	Het
Dnajc11	A	G	4: 151,978,093		probably benign	Het
Dock4	T	C	12: 40,844,267	S1847P	probably damaging	Het
Dync2h1	A	G	9: 7,131,881	V1642A	probably benign	Het
Eftud2	T	C	11: 102,839,416		probably null	Het
Fam221b	A	G	4: 43,665,987	I208T	probably benign	Het
Gpr37l1	T	C	1: 135,161,563	I255V	probably benign	Het
Grm7	G	A	6: 110,914,340	S178N	probably damaging	Het
Hspa12b	T	A	2: 131,133,488		probably null	Het
Kctd3	A	T	1: 188,995,720		probably benign	Het
Kynu	G	A	2: 43,679,872	V389M	possibly damaging	Het
Lcat	A	G	8: 105,939,906	L328P	probably benign	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Maml1	G	A	11: 50,291,829	P78L	probably benign	Het
Mef2b	G	A	8: 70,165,102	V37M	probably damaging	Het
Mindy2	A	T	9: 70,634,060	M281K	probably damaging	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Mtr	A	T	13: 12,231,057	V394E	probably damaging	Het
Myh14	T	A	7: 44,632,991	T745S	possibly damaging	Het
Nme9	T	A	9: 99,464,527	D131E	possibly damaging	Het
Nphp4	C	A	4: 152,547,018	Q792K	probably damaging	Het
Nrxn2	T	A	19: 6,473,414	C479S	probably damaging	Het
Nsmf	T	C	2: 25,060,859	I406T	probably damaging	Het
Olfr1431	A	T	19: 12,209,779	D71V	probably damaging	Het
Olfr517	G	A	7: 108,868,443	A237V	probably damaging	Het
Olfr945	T	A	9: 39,258,034	I213F	possibly damaging	Het
Pbrm1	A	G	14: 31,036,003	T197A	probably benign	Het
Pla2r1	T	A	2: 60,432,593	N1034I	probably damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp1	A	T	3: 79,644,761	D744E	probably benign	Het
Samd9l	T	C	6: 3,376,887	N125D	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Slc22a30	C	T	19: 8,404,545	V121M	probably damaging	Het
Smarcc1	T	A	9: 110,164,829	D247E	possibly damaging	Het
Smg9	T	A	7: 24,420,867	L422Q	probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Utrn	T	A	10: 12,710,171	D954V	probably benign	Het
Vmn1r227	T	A	17: 20,735,516		noncoding transcript	Het
Vmn2r11	A	C	5: 109,054,750		probably null	Het
Vmn2r84	A	T	10: 130,391,369	M200K	probably damaging	Het
Vmn2r88	T	A	14: 51,415,426	Y469N	probably damaging	Het
Wdcp	A	G	12: 4,855,279	N600S	probably null	Het
Wdfy4	T	G	14: 33,125,880	R838S	possibly damaging	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1521:Casp8ap2	UTSW	4	32631867	missense	probably damaging	1.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CATTTTGCCTTAAAGGAGGAAAGG -3'
(R):5'- CCGTTGTCCTTATGCACATG -3'

Sequencing Primer
(F):5'- GGCTAATACTCAGTGGTCA -3'
(R):5'- GCACATGCACAGTGCTCCTC -3'

Posted On

2015-05-15