Incidental Mutation 'R4091:Fam221b'
ID317598
Institutional Source Beutler Lab
Gene Symbol Fam221b
Ensembl Gene ENSMUSG00000043633
Gene Namefamily with sequence similarity 221, member B
Synonyms
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4091 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43659622-43669145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43665987 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 208 (I208T)
Ref Sequence ENSEMBL: ENSMUSP00000057398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056474] [ENSMUST00000107864] [ENSMUST00000107865] [ENSMUST00000107866] [ENSMUST00000143339] [ENSMUST00000167153]
Predicted Effect probably benign
Transcript: ENSMUST00000056474
AA Change: I208T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000057398
Gene: ENSMUSG00000043633
AA Change: I208T

DomainStartEndE-ValueType
low complexity region 81 105 N/A INTRINSIC
internal_repeat_1 119 164 1.12e-19 PROSPERO
internal_repeat_1 165 210 1.12e-19 PROSPERO
low complexity region 267 285 N/A INTRINSIC
Pfam:DUF4475 312 482 1.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102482
Predicted Effect probably benign
Transcript: ENSMUST00000107864
SMART Domains Protein: ENSMUSP00000103496
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107865
SMART Domains Protein: ENSMUSP00000103497
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107866
SMART Domains Protein: ENSMUSP00000103498
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 45 71 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 115 137 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
EGF 606 642 1.95e1 SMART
Pfam:DUF3522 652 836 1.4e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134869
Predicted Effect probably benign
Transcript: ENSMUST00000143339
SMART Domains Protein: ENSMUSP00000130133
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143774
Predicted Effect probably benign
Transcript: ENSMUST00000167153
SMART Domains Protein: ENSMUSP00000129760
Gene: ENSMUSG00000078716

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
EGF 185 221 1.95e1 SMART
Pfam:DUF3522 229 415 2.1e-70 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Fam221b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Fam221b APN 4 43660135 unclassified probably null
IGL01576:Fam221b APN 4 43666227 missense probably benign 0.21
IGL02126:Fam221b APN 4 43666450 missense probably benign 0.01
IGL02407:Fam221b APN 4 43666309 missense possibly damaging 0.73
IGL02425:Fam221b APN 4 43660642 critical splice donor site probably null
IGL03174:Fam221b APN 4 43666542 missense probably benign 0.00
F5770:Fam221b UTSW 4 43665865 missense probably benign
R1785:Fam221b UTSW 4 43665537 missense probably damaging 0.99
R1786:Fam221b UTSW 4 43665537 missense probably damaging 0.99
R1896:Fam221b UTSW 4 43660375 missense probably damaging 0.98
R4695:Fam221b UTSW 4 43659622 splice site probably null
R5024:Fam221b UTSW 4 43659674 missense probably damaging 1.00
R5778:Fam221b UTSW 4 43660683 missense probably damaging 1.00
R6335:Fam221b UTSW 4 43665942 missense possibly damaging 0.89
V7580:Fam221b UTSW 4 43665865 missense probably benign
V7581:Fam221b UTSW 4 43665865 missense probably benign
V7582:Fam221b UTSW 4 43665865 missense probably benign
V7583:Fam221b UTSW 4 43665865 missense probably benign
Z1177:Fam221b UTSW 4 43666039 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTTCTTTGCACGAAGCCCAG -3'
(R):5'- TCCCATCTCTGAAGTCCAAAAG -3'

Sequencing Primer
(F):5'- GCTGCAGGGATCTTACTAGTACC -3'
(R):5'- AAGGAATCTCTTGAGGTCTCACC -3'
Posted On2015-05-15