Incidental Mutation 'R4091:Speer3'
ID317601
Institutional Source Beutler Lab
Gene Symbol Speer3
Ensembl Gene ENSMUSG00000067855
Gene Namespermatogenesis associated glutamate (E)-rich protein 3
SynonymsSPEER-3, 4933405P08Rik
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4091 (G1)
Quality Score194
Status Not validated
Chromosome5
Chromosomal Location13791619-13796820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 13796380 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 238 (A238G)
Ref Sequence ENSEMBL: ENSMUSP00000115668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124677
AA Change: A238G

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115668
Gene: ENSMUSG00000067855
AA Change: A238G

DomainStartEndE-ValueType
Pfam:Takusan 48 134 2.3e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199961
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Speer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Speer3 APN 5 13793222 nonsense probably null
IGL02730:Speer3 APN 5 13793271 missense probably benign
IGL03192:Speer3 APN 5 13791688 missense possibly damaging 0.93
IGL03301:Speer3 APN 5 13795433 missense probably damaging 1.00
R1623:Speer3 UTSW 5 13796321 missense probably benign
R3028:Speer3 UTSW 5 13795431 missense probably damaging 0.99
R4092:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4368:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4369:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4405:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4450:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4509:Speer3 UTSW 5 13796354 missense possibly damaging 0.72
R4594:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R4702:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R5096:Speer3 UTSW 5 13796380 missense possibly damaging 0.70
R5508:Speer3 UTSW 5 13794664 missense probably damaging 0.97
R5583:Speer3 UTSW 5 13794768 critical splice donor site probably null
R6061:Speer3 UTSW 5 13794691 missense possibly damaging 0.88
R6337:Speer3 UTSW 5 13793355 missense probably damaging 0.96
R6518:Speer3 UTSW 5 13795448 missense possibly damaging 0.66
R7503:Speer3 UTSW 5 13793334 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCCCTGCATGTATAGAACAGC -3'
(R):5'- CAGACCTACAGCCTGTATCTCC -3'

Sequencing Primer
(F):5'- CCCTGCATGTATAGAACAGCAATGG -3'
(R):5'- AGCCTGTATCTCCTCTTGGACTG -3'
Posted On2015-05-15