Incidental Mutation 'R4091:Myh14'
ID 317609
Institutional Source Beutler Lab
Gene Symbol Myh14
Ensembl Gene ENSMUSG00000030739
Gene Name myosin, heavy polypeptide 14
Synonyms NMHC II-C, 2400004E04Rik
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4091 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 44605803-44670843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44632991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 745 (T745S)
Ref Sequence ENSEMBL: ENSMUSP00000103531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048102] [ENSMUST00000107899] [ENSMUST00000107900] [ENSMUST00000207775]
AlphaFold Q6URW6
Predicted Effect possibly damaging
Transcript: ENSMUST00000048102
AA Change: T753S

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046059
Gene: ENSMUSG00000030739
AA Change: T753S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Blast:MYSc 839 872 1e-12 BLAST
low complexity region 880 891 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1005 1013 N/A INTRINSIC
low complexity region 1021 1029 N/A INTRINSIC
low complexity region 1030 1041 N/A INTRINSIC
Pfam:Myosin_tail_1 1094 1951 9.3e-180 PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107899
AA Change: T745S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103531
Gene: ENSMUSG00000030739
AA Change: T745S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 797 N/A SMART
IQ 798 820 3.91e-4 SMART
Blast:MYSc 831 864 1e-12 BLAST
low complexity region 872 883 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 997 1005 N/A INTRINSIC
low complexity region 1013 1021 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Pfam:Myosin_tail_1 1086 1943 9e-180 PFAM
low complexity region 1947 1958 N/A INTRINSIC
low complexity region 1960 1989 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107900
AA Change: T753S

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103532
Gene: ENSMUSG00000030739
AA Change: T753S

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Pfam:Myosin_tail_1 869 1949 N/A PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207775
AA Change: T786S

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208085
Predicted Effect unknown
Transcript: ENSMUST00000208200
AA Change: T431S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209024
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and survive to adulthood with no apparent defects. About 30% of knock-in mice either heterozygous or homozygous for a single amino acid mutation exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Myh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Myh14 APN 7 44606292 unclassified probably benign
IGL01431:Myh14 APN 7 44614358 missense probably null 0.00
IGL01722:Myh14 APN 7 44643532 missense probably damaging 1.00
IGL01806:Myh14 APN 7 44657939 missense probably benign 0.19
IGL02034:Myh14 APN 7 44616293 missense possibly damaging 0.58
IGL02260:Myh14 APN 7 44611571 missense probably damaging 1.00
IGL02590:Myh14 APN 7 44624079 missense probably damaging 1.00
IGL02696:Myh14 APN 7 44665106 missense probably damaging 1.00
IGL02705:Myh14 APN 7 44608536 missense possibly damaging 0.66
IGL03193:Myh14 APN 7 44629945 missense possibly damaging 0.91
PIT4581001:Myh14 UTSW 7 44613482 missense probably benign 0.04
R0067:Myh14 UTSW 7 44623127 missense probably benign 0.05
R0083:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0108:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0152:Myh14 UTSW 7 44623181 missense probably damaging 1.00
R0369:Myh14 UTSW 7 44660950 missense probably damaging 1.00
R0552:Myh14 UTSW 7 44613681 missense probably damaging 1.00
R0699:Myh14 UTSW 7 44624971 missense possibly damaging 0.67
R0763:Myh14 UTSW 7 44665367 missense probably damaging 0.98
R1079:Myh14 UTSW 7 44630002 missense probably damaging 1.00
R1388:Myh14 UTSW 7 44665122 missense probably damaging 0.98
R1432:Myh14 UTSW 7 44616299 missense probably damaging 1.00
R1568:Myh14 UTSW 7 44611698 nonsense probably null
R1579:Myh14 UTSW 7 44655694 splice site probably null
R1598:Myh14 UTSW 7 44638394 missense probably damaging 0.96
R1848:Myh14 UTSW 7 44632429 missense probably damaging 0.98
R1869:Myh14 UTSW 7 44611643 missense possibly damaging 0.95
R1917:Myh14 UTSW 7 44657925 missense probably benign
R1933:Myh14 UTSW 7 44615348 missense probably benign 0.09
R1984:Myh14 UTSW 7 44639022 missense probably damaging 1.00
R2154:Myh14 UTSW 7 44652429 critical splice donor site probably null
R2190:Myh14 UTSW 7 44661063 missense probably damaging 1.00
R2217:Myh14 UTSW 7 44634376 missense probably damaging 1.00
R2239:Myh14 UTSW 7 44665183 missense probably damaging 1.00
R2918:Myh14 UTSW 7 44616263 missense possibly damaging 0.91
R4110:Myh14 UTSW 7 44628550 missense probably benign 0.00
R4199:Myh14 UTSW 7 44615503 nonsense probably null
R4507:Myh14 UTSW 7 44629991 missense probably benign 0.00
R4539:Myh14 UTSW 7 44627054 missense probably damaging 1.00
R4550:Myh14 UTSW 7 44634433 missense probably damaging 1.00
R4673:Myh14 UTSW 7 44624330 missense probably damaging 1.00
R4768:Myh14 UTSW 7 44613675 missense probably benign 0.19
R4832:Myh14 UTSW 7 44625142 missense probably benign 0.31
R4853:Myh14 UTSW 7 44608448 missense probably damaging 1.00
R4901:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R4928:Myh14 UTSW 7 44635502 missense probably benign 0.00
R5070:Myh14 UTSW 7 44616248 missense possibly damaging 0.91
R5166:Myh14 UTSW 7 44628855 missense probably damaging 0.99
R5726:Myh14 UTSW 7 44643462 critical splice donor site probably null
R5786:Myh14 UTSW 7 44613463 missense probably benign 0.23
R5895:Myh14 UTSW 7 44606709 missense probably damaging 1.00
R5961:Myh14 UTSW 7 44623094 missense probably damaging 0.96
R6014:Myh14 UTSW 7 44625078 missense probably null
R6080:Myh14 UTSW 7 44655611 missense probably damaging 1.00
R6187:Myh14 UTSW 7 44627033 missense probably damaging 1.00
R6657:Myh14 UTSW 7 44637846 missense probably damaging 1.00
R6833:Myh14 UTSW 7 44624379 nonsense probably null
R6894:Myh14 UTSW 7 44633512 missense probably damaging 1.00
R6916:Myh14 UTSW 7 44629313 missense probably damaging 0.96
R6962:Myh14 UTSW 7 44657939 missense probably benign 0.36
R7066:Myh14 UTSW 7 44630755 missense possibly damaging 0.69
R7261:Myh14 UTSW 7 44624337 nonsense probably null
R7303:Myh14 UTSW 7 44611701 missense probably damaging 1.00
R7304:Myh14 UTSW 7 44629991 missense probably benign 0.00
R7327:Myh14 UTSW 7 44611553 missense possibly damaging 0.53
R7380:Myh14 UTSW 7 44661042 missense probably damaging 1.00
R7570:Myh14 UTSW 7 44632426 missense probably benign 0.37
R7622:Myh14 UTSW 7 44632422 missense probably benign 0.25
R7681:Myh14 UTSW 7 44624148 missense possibly damaging 0.81
R7718:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R7910:Myh14 UTSW 7 44632395 missense probably damaging 1.00
R8054:Myh14 UTSW 7 44625127 missense probably damaging 0.97
R8088:Myh14 UTSW 7 44665496 start codon destroyed probably null 0.94
R8164:Myh14 UTSW 7 44625033 missense probably benign 0.01
R8260:Myh14 UTSW 7 44615376 missense probably damaging 1.00
R8299:Myh14 UTSW 7 44627048 missense probably damaging 1.00
R8410:Myh14 UTSW 7 44633483 missense probably damaging 1.00
R8723:Myh14 UTSW 7 44622983 missense probably damaging 1.00
R8853:Myh14 UTSW 7 44616254 missense probably benign 0.08
R8934:Myh14 UTSW 7 44657428 missense probably benign
R9169:Myh14 UTSW 7 44621857 missense possibly damaging 0.73
R9395:Myh14 UTSW 7 44625160 missense possibly damaging 0.66
X0026:Myh14 UTSW 7 44614394 missense probably benign 0.00
X0063:Myh14 UTSW 7 44624133 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44608515 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44638309 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTCCAAGGCTTCCCATAC -3'
(R):5'- GCAAGTGTGCGATCCTCTATAC -3'

Sequencing Primer
(F):5'- GGTCCAAGGCTTCCCATACATCTC -3'
(R):5'- ACCTGGTCTACGTAGCGAGTTC -3'
Posted On 2015-05-15