Incidental Mutation 'R0392:S1pr5'
ID31761
Institutional Source Beutler Lab
Gene Symbol S1pr5
Ensembl Gene ENSMUSG00000045087
Gene Namesphingosine-1-phosphate receptor 5
SynonymsS1P5, Edg8, lpB4
MMRRC Submission 038598-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R0392 (G1)
Quality Score203
Status Validated
Chromosome9
Chromosomal Location21242912-21248443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21244981 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 50 (I50F)
Ref Sequence ENSEMBL: ENSMUSP00000113843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122088]
Predicted Effect probably damaging
Transcript: ENSMUST00000122088
AA Change: I50F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113843
Gene: ENSMUSG00000045087
AA Change: I50F

DomainStartEndE-ValueType
Pfam:7tm_1 53 307 9.6e-37 PFAM
low complexity region 318 327 N/A INTRINSIC
low complexity region 340 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215491
Meta Mutation Damage Score 0.2998 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The lysosphingolipid sphingosine 1-phosphate (S1P) regulates cell proliferation, apoptosis, motility, and neurite retraction. Its actions may be both intracellular as a second messenger and extracellular as a receptor ligand. S1P and the structurally related lysolipid mediator lysophosphatidic acid (LPA) signal cells through a set of G protein-coupled receptors known as EDG receptors. Some EDG receptors (e.g., EDG1; MIM 601974) are S1P receptors; others (e.g., EDG2; MIM 602282) are LPA receptors.[supplied by OMIM, Mar 2008]
PHENOTYPE: Bone marrow from mice homozygous for a knock-out allele induces impaired NK cell egression from the lymph nodes and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik T C 16: 4,977,499 noncoding transcript Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bcan T A 3: 87,993,562 K455* probably null Het
Casp12 T A 9: 5,348,973 probably benign Het
Ccdc61 T C 7: 18,891,102 M504V probably benign Het
Cd53 A T 3: 106,763,276 V147E probably damaging Het
Cyp2b13 T C 7: 26,085,883 Y226H probably benign Het
Cyp2j7 T C 4: 96,199,434 D413G probably damaging Het
Dcbld1 T C 10: 52,317,134 I254T possibly damaging Het
Ddx39 T G 8: 83,721,737 M206R probably damaging Het
Dgki T A 6: 37,000,178 T666S probably damaging Het
Dnah7a C A 1: 53,504,198 C2271F probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Epha4 T C 1: 77,506,973 K133R probably benign Het
Gm11146 T A 16: 77,597,166 probably benign Het
Ift88 A T 14: 57,496,160 probably benign Het
Ighv10-3 A G 12: 114,523,840 probably benign Het
Lamp5 T C 2: 136,060,897 S179P probably damaging Het
Map4 T C 9: 110,078,045 S788P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,762 I279N possibly damaging Het
Otog T C 7: 46,250,075 W267R probably benign Het
Pafah1b2 T C 9: 45,968,853 I175M probably benign Het
Pcdhb12 A G 18: 37,436,958 K386E possibly damaging Het
Pcnt T C 10: 76,384,826 N2056S probably benign Het
Pold2 T C 11: 5,876,776 I53V possibly damaging Het
Rsf1 T A 7: 97,679,005 D1071E probably benign Het
Rtp3 A T 9: 110,989,553 M20K probably damaging Het
Slc47a1 A G 11: 61,371,782 S94P probably damaging Het
Slitrk5 G A 14: 111,679,033 V30I probably benign Het
St8sia5 G A 18: 77,254,406 V271M probably damaging Het
Sult2b1 G T 7: 45,733,638 T240N probably damaging Het
Other mutations in S1pr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:S1pr5 APN 9 21244216 missense possibly damaging 0.55
IGL01719:S1pr5 APN 9 21243954 missense probably benign 0.03
sipho UTSW 9 21244129 missense probably benign 0.01
R0448:S1pr5 UTSW 9 21244207 missense probably damaging 1.00
R1599:S1pr5 UTSW 9 21243934 missense probably benign 0.02
R1703:S1pr5 UTSW 9 21244050 missense possibly damaging 0.52
R1850:S1pr5 UTSW 9 21244129 missense probably benign 0.01
R2095:S1pr5 UTSW 9 21244858 missense probably benign 0.04
R2178:S1pr5 UTSW 9 21244464 missense probably benign 0.36
R3082:S1pr5 UTSW 9 21244990 missense probably damaging 1.00
R3430:S1pr5 UTSW 9 21245082 missense probably benign 0.00
R5578:S1pr5 UTSW 9 21244551 missense probably damaging 1.00
R7444:S1pr5 UTSW 9 21245082 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGTAAGGTGGCGCTCTAAAGCAATG -3'
(R):5'- TTTGCACAGTGCTCCAGTGGAC -3'

Sequencing Primer
(F):5'- AGAGGCTCAGCACCGAC -3'
(R):5'- CAGCAGCGACATCTCCG -3'
Posted On2013-04-24