Incidental Mutation 'R4091:Mef2b'
ID317612
Institutional Source Beutler Lab
Gene Symbol Mef2b
Ensembl Gene ENSMUSG00000079033
Gene Namemyocyte enhancer factor 2B
Synonyms
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4091 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70139711-70167488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70165102 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 37 (V37M)
Ref Sequence ENSEMBL: ENSMUSP00000132314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110140] [ENSMUST00000110141] [ENSMUST00000110143] [ENSMUST00000110146] [ENSMUST00000163756]
Predicted Effect probably damaging
Transcript: ENSMUST00000110140
AA Change: V37M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105767
Gene: ENSMUSG00000079033
AA Change: V37M

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110141
AA Change: V37M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105768
Gene: ENSMUSG00000079033
AA Change: V37M

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110143
AA Change: V37M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105770
Gene: ENSMUSG00000079033
AA Change: V37M

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110146
AA Change: V37M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105773
Gene: ENSMUSG00000079033
AA Change: V37M

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163756
AA Change: V37M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033
AA Change: V37M

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Meta Mutation Damage Score 0.8407 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Mef2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Mef2b UTSW 8 70164260 missense probably damaging 1.00
R1023:Mef2b UTSW 8 70165597 missense possibly damaging 0.82
R4162:Mef2b UTSW 8 70166311 missense probably damaging 1.00
R4562:Mef2b UTSW 8 70167268 missense probably damaging 1.00
R4950:Mef2b UTSW 8 70167196 missense probably damaging 1.00
R5318:Mef2b UTSW 8 70166843 missense probably damaging 0.99
R5752:Mef2b UTSW 8 70165617 missense possibly damaging 0.77
R6126:Mef2b UTSW 8 70166876 missense probably benign 0.01
R6279:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6300:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6332:Mef2b UTSW 8 70164139 intron probably null
R6369:Mef2b UTSW 8 70165559 missense probably benign 0.05
R6873:Mef2b UTSW 8 70166307 missense probably benign 0.29
R7266:Mef2b UTSW 8 70164288 missense probably damaging 1.00
X0022:Mef2b UTSW 8 70166834 missense probably benign 0.41
Z1176:Mef2b UTSW 8 70166375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAACACCCTGCTTTAACC -3'
(R):5'- AACAGGGTGACACAGTGACC -3'

Sequencing Primer
(F):5'- AACACCCTGCTTTAACCCTCCTC -3'
(R):5'- GGTGACACAGTGACCAACCG -3'
Posted On2015-05-15