Incidental Mutation 'R4091:Eftud2'
ID 317626
Institutional Source Beutler Lab
Gene Symbol Eftud2
Ensembl Gene ENSMUSG00000020929
Gene Name elongation factor Tu GTP binding domain containing 2
Synonyms 116kDa, Snrp116, U5-116kD
MMRRC Submission 041626-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4091 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 102729299-102771811 bp(-) (GRCm39)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 102730242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021302] [ENSMUST00000021306] [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000107072] [ENSMUST00000107073] [ENSMUST00000173679] [ENSMUST00000173679]
AlphaFold O08810
Predicted Effect probably benign
Transcript: ENSMUST00000021302
SMART Domains Protein: ENSMUSP00000021302
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107072
SMART Domains Protein: ENSMUSP00000102687
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107073
SMART Domains Protein: ENSMUSP00000102688
Gene: ENSMUSG00000020928

DomainStartEndE-ValueType
Pfam:HIG_1_N 25 79 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132543
SMART Domains Protein: ENSMUSP00000133732
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFG_IV 1 65 2.9e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173679
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173679
SMART Domains Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 29 51 N/A INTRINSIC
Pfam:GTP_EFTU 127 430 2.2e-36 PFAM
Pfam:GTP_EFTU_D2 479 556 7.8e-13 PFAM
Pfam:EFG_II 574 646 8.1e-10 PFAM
EFG_IV 693 814 1.1e-16 SMART
EFG_C 816 905 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143323
Predicted Effect probably benign
Transcript: ENSMUST00000172611
SMART Domains Protein: ENSMUSP00000134316
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 85 98 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,575,722 (GRCm39) S674P possibly damaging Het
Abca3 C T 17: 24,616,456 (GRCm39) T966M probably damaging Het
Adam2 A T 14: 66,267,172 (GRCm39) Y696N probably damaging Het
Alas1 G T 9: 106,119,000 (GRCm39) probably null Het
Arhgap25 G T 6: 87,440,017 (GRCm39) S543R probably benign Het
Bckdk C A 7: 127,504,590 (GRCm39) R105S probably damaging Het
Bltp1 G A 3: 37,084,738 (GRCm39) A3897T probably benign Het
Carns1 C T 19: 4,221,682 (GRCm39) R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 (GRCm39) P895T probably damaging Het
Col12a1 T A 9: 79,609,646 (GRCm39) I287F probably damaging Het
Cystm1 A G 18: 36,499,600 (GRCm39) N5S unknown Het
Dnah8 T C 17: 30,988,813 (GRCm39) V3261A probably damaging Het
Dnajc11 A G 4: 152,062,550 (GRCm39) probably benign Het
Dock4 T C 12: 40,894,266 (GRCm39) S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 (GRCm39) V1642A probably benign Het
Fam221b A G 4: 43,665,987 (GRCm39) I208T probably benign Het
Gpr141b T A 13: 19,913,635 (GRCm39) noncoding transcript Het
Gpr37l1 T C 1: 135,089,301 (GRCm39) I255V probably benign Het
Grm7 G A 6: 110,891,301 (GRCm39) S178N probably damaging Het
Hspa12b T A 2: 130,975,408 (GRCm39) probably null Het
Kctd3 A T 1: 188,727,917 (GRCm39) probably benign Het
Kynu G A 2: 43,569,884 (GRCm39) V389M possibly damaging Het
Lcat A G 8: 106,666,538 (GRCm39) L328P probably benign Het
Lrrn2 C T 1: 132,865,390 (GRCm39) Q152* probably null Het
Maml1 G A 11: 50,182,656 (GRCm39) P78L probably benign Het
Mef2b G A 8: 70,617,752 (GRCm39) V37M probably damaging Het
Mindy2 A T 9: 70,541,342 (GRCm39) M281K probably damaging Het
Mon2 C T 10: 122,874,415 (GRCm39) R311H probably damaging Het
Mtr A T 13: 12,245,943 (GRCm39) V394E probably damaging Het
Myh14 T A 7: 44,282,415 (GRCm39) T745S possibly damaging Het
Nme9 T A 9: 99,346,580 (GRCm39) D131E possibly damaging Het
Nphp4 C A 4: 152,631,475 (GRCm39) Q792K probably damaging Het
Nrxn2 T A 19: 6,523,444 (GRCm39) C479S probably damaging Het
Nsmf T C 2: 24,950,871 (GRCm39) I406T probably damaging Het
Or10a49 G A 7: 108,467,650 (GRCm39) A237V probably damaging Het
Or5an9 A T 19: 12,187,143 (GRCm39) D71V probably damaging Het
Or8g28 T A 9: 39,169,330 (GRCm39) I213F possibly damaging Het
Pbrm1 A G 14: 30,757,960 (GRCm39) T197A probably benign Het
Pla2r1 T A 2: 60,262,937 (GRCm39) N1034I probably damaging Het
Rps6-ps2 A G 8: 89,533,319 (GRCm39) noncoding transcript Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Rxfp1 A T 3: 79,552,068 (GRCm39) D744E probably benign Het
Samd9l T C 6: 3,376,887 (GRCm39) N125D probably benign Het
Serpina3a G A 12: 104,082,625 (GRCm39) V133I probably benign Het
Slc22a30 C T 19: 8,381,909 (GRCm39) V121M probably damaging Het
Smarcc1 T A 9: 109,993,897 (GRCm39) D247E possibly damaging Het
Smg9 T A 7: 24,120,292 (GRCm39) L422Q probably null Het
Speer3 C G 5: 13,846,394 (GRCm39) A238G possibly damaging Het
Tle5 G A 10: 81,401,418 (GRCm39) G162D probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Utrn T A 10: 12,585,915 (GRCm39) D954V probably benign Het
Vmn1r227 T A 17: 20,955,778 (GRCm39) noncoding transcript Het
Vmn2r11 A C 5: 109,202,616 (GRCm39) probably null Het
Vmn2r84 A T 10: 130,227,238 (GRCm39) M200K probably damaging Het
Vmn2r88 T A 14: 51,652,883 (GRCm39) Y469N probably damaging Het
Wdcp A G 12: 4,905,279 (GRCm39) N600S probably null Het
Wdfy4 T G 14: 32,847,837 (GRCm39) R838S possibly damaging Het
Other mutations in Eftud2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Eftud2 APN 11 102,756,389 (GRCm39) splice site probably benign
IGL01765:Eftud2 APN 11 102,730,082 (GRCm39) missense probably damaging 0.99
IGL01868:Eftud2 APN 11 102,759,953 (GRCm39) missense probably benign 0.08
IGL02161:Eftud2 APN 11 102,745,702 (GRCm39) splice site probably benign
IGL02165:Eftud2 APN 11 102,742,573 (GRCm39) splice site probably benign
IGL02218:Eftud2 APN 11 102,761,039 (GRCm39) missense possibly damaging 0.46
IGL02386:Eftud2 APN 11 102,742,580 (GRCm39) splice site probably null
IGL02664:Eftud2 APN 11 102,732,538 (GRCm39) missense probably damaging 1.00
IGL02677:Eftud2 APN 11 102,737,440 (GRCm39) missense probably damaging 1.00
IGL02792:Eftud2 APN 11 102,761,082 (GRCm39) splice site probably benign
IGL02870:Eftud2 APN 11 102,753,452 (GRCm39) missense probably damaging 0.97
IGL03131:Eftud2 APN 11 102,761,009 (GRCm39) missense probably damaging 1.00
R0137:Eftud2 UTSW 11 102,759,443 (GRCm39) missense possibly damaging 0.94
R0244:Eftud2 UTSW 11 102,755,551 (GRCm39) missense probably damaging 0.97
R0358:Eftud2 UTSW 11 102,755,627 (GRCm39) splice site probably benign
R0463:Eftud2 UTSW 11 102,755,597 (GRCm39) missense probably damaging 1.00
R0511:Eftud2 UTSW 11 102,735,048 (GRCm39) missense probably damaging 1.00
R0525:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R0586:Eftud2 UTSW 11 102,737,446 (GRCm39) missense probably damaging 1.00
R0751:Eftud2 UTSW 11 102,730,079 (GRCm39) missense probably damaging 1.00
R1034:Eftud2 UTSW 11 102,740,010 (GRCm39) missense probably benign
R1079:Eftud2 UTSW 11 102,730,870 (GRCm39) nonsense probably null
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1208:Eftud2 UTSW 11 102,755,592 (GRCm39) missense probably benign 0.22
R1220:Eftud2 UTSW 11 102,742,573 (GRCm39) splice site probably benign
R1438:Eftud2 UTSW 11 102,750,868 (GRCm39) missense probably damaging 1.00
R1520:Eftud2 UTSW 11 102,730,266 (GRCm39) missense probably damaging 1.00
R1569:Eftud2 UTSW 11 102,745,597 (GRCm39) splice site probably benign
R2270:Eftud2 UTSW 11 102,755,607 (GRCm39) missense probably damaging 1.00
R3500:Eftud2 UTSW 11 102,735,006 (GRCm39) missense probably damaging 1.00
R3686:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3687:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3688:Eftud2 UTSW 11 102,735,027 (GRCm39) missense probably damaging 1.00
R3808:Eftud2 UTSW 11 102,732,289 (GRCm39) splice site probably null
R3892:Eftud2 UTSW 11 102,737,013 (GRCm39) missense probably damaging 0.99
R4003:Eftud2 UTSW 11 102,750,936 (GRCm39) missense possibly damaging 0.51
R4794:Eftud2 UTSW 11 102,761,003 (GRCm39) missense probably benign 0.14
R4841:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R4842:Eftud2 UTSW 11 102,745,640 (GRCm39) missense probably damaging 1.00
R5151:Eftud2 UTSW 11 102,758,670 (GRCm39) critical splice donor site probably null
R5208:Eftud2 UTSW 11 102,732,011 (GRCm39) missense probably damaging 1.00
R6199:Eftud2 UTSW 11 102,730,883 (GRCm39) missense probably damaging 1.00
R6357:Eftud2 UTSW 11 102,755,606 (GRCm39) missense probably damaging 1.00
R6720:Eftud2 UTSW 11 102,729,449 (GRCm39) nonsense probably null
R7604:Eftud2 UTSW 11 102,738,838 (GRCm39) missense possibly damaging 0.87
R7886:Eftud2 UTSW 11 102,730,934 (GRCm39) missense probably damaging 1.00
R8017:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8019:Eftud2 UTSW 11 102,734,174 (GRCm39) critical splice donor site probably null
R8139:Eftud2 UTSW 11 102,758,685 (GRCm39) missense probably benign 0.04
R8431:Eftud2 UTSW 11 102,737,062 (GRCm39) missense probably benign 0.08
R8545:Eftud2 UTSW 11 102,731,097 (GRCm39) missense probably damaging 1.00
R8676:Eftud2 UTSW 11 102,759,447 (GRCm39) missense probably damaging 1.00
R9089:Eftud2 UTSW 11 102,759,971 (GRCm39) missense probably benign
R9173:Eftud2 UTSW 11 102,734,242 (GRCm39) missense probably damaging 1.00
R9277:Eftud2 UTSW 11 102,750,855 (GRCm39) missense probably damaging 1.00
R9313:Eftud2 UTSW 11 102,730,262 (GRCm39) missense probably benign 0.03
R9604:Eftud2 UTSW 11 102,737,056 (GRCm39) missense probably benign 0.11
R9664:Eftud2 UTSW 11 102,759,422 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCGAATGACAATGCTCTTG -3'
(R):5'- GTCGATATACAACTCTGGCCTTG -3'

Sequencing Primer
(F):5'- TCTTGTCCAGAGGATCGCC -3'
(R):5'- ATATACAACTCTGGCCTTGGCTTTTG -3'
Posted On 2015-05-15