Mutagenetix > Incidental Mutation

Incidental Mutation 'R4091:Vmn2r88'

317634

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r88

Ensembl Gene

ENSMUSG00000000606

Gene Name

vomeronasal 2, receptor 88

Synonyms

V2r3, V2r13

MMRRC Submission

041626-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R4091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51410819-51419527 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 51415426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 469 (Y469N)

Ref Sequence

ENSEMBL: ENSMUSP00000022438 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022438] [ENSMUST00000159674] [ENSMUST00000162998] [ENSMUST00000228139]

AlphaFold

L7N1W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000022438
AA Change: Y469N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022438
Gene: ENSMUSG00000000606
AA Change: Y469N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:ANF_receptor	76	457	8.3e-27	PFAM
Pfam:NCD3G	516	570	1.2e-18	PFAM
Pfam:7tm_3	603	838	1.9e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159674
AA Change: Y461N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125126
Gene: ENSMUSG00000000606
AA Change: Y461N

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	30	408	3.2e-30	PFAM
Pfam:NCD3G	463	516	1.2e-19	PFAM
Pfam:7tm_3	546	785	3.7e-81	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161565

Predicted Effect

probably benign
Transcript: ENSMUST00000162998

SMART Domains

Protein: ENSMUSP00000125409
Gene: ENSMUSG00000068399

Domain	Start	End	E-Value	Type
Pfam:Takusan	35	115	2.2e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163019

SMART Domains

Protein: ENSMUSP00000124837
Gene: ENSMUSG00000000606

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	52	399	3.7e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000228139
AA Change: Y461N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,745,378	S674P	possibly damaging	Het
4932438A13Rik	G	A	3: 37,030,589	A3897T	probably benign	Het
A530099J19Rik	T	A	13: 19,729,465		noncoding transcript	Het
Abca3	C	T	17: 24,397,482	T966M	probably damaging	Het
Adam2	A	T	14: 66,029,723	Y696N	probably damaging	Het
Aes	G	A	10: 81,565,584	G162D	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap25	G	T	6: 87,463,035	S543R	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Carns1	C	T	19: 4,171,683	R191Q	probably damaging	Het
Casp8ap2	C	A	4: 32,643,611	P895T	probably damaging	Het
Col12a1	T	A	9: 79,702,364	I287F	probably damaging	Het
Cystm1	A	G	18: 36,366,547	N5S	unknown	Het
Dnah8	T	C	17: 30,769,839	V3261A	probably damaging	Het
Dnajc11	A	G	4: 151,978,093		probably benign	Het
Dock4	T	C	12: 40,844,267	S1847P	probably damaging	Het
Dync2h1	A	G	9: 7,131,881	V1642A	probably benign	Het
Eftud2	T	C	11: 102,839,416		probably null	Het
Fam221b	A	G	4: 43,665,987	I208T	probably benign	Het
Gpr37l1	T	C	1: 135,161,563	I255V	probably benign	Het
Grm7	G	A	6: 110,914,340	S178N	probably damaging	Het
Hspa12b	T	A	2: 131,133,488		probably null	Het
Kctd3	A	T	1: 188,995,720		probably benign	Het
Kynu	G	A	2: 43,679,872	V389M	possibly damaging	Het
Lcat	A	G	8: 105,939,906	L328P	probably benign	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Maml1	G	A	11: 50,291,829	P78L	probably benign	Het
Mef2b	G	A	8: 70,165,102	V37M	probably damaging	Het
Mindy2	A	T	9: 70,634,060	M281K	probably damaging	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Mtr	A	T	13: 12,231,057	V394E	probably damaging	Het
Myh14	T	A	7: 44,632,991	T745S	possibly damaging	Het
Nme9	T	A	9: 99,464,527	D131E	possibly damaging	Het
Nphp4	C	A	4: 152,547,018	Q792K	probably damaging	Het
Nrxn2	T	A	19: 6,473,414	C479S	probably damaging	Het
Nsmf	T	C	2: 25,060,859	I406T	probably damaging	Het
Olfr1431	A	T	19: 12,209,779	D71V	probably damaging	Het
Olfr517	G	A	7: 108,868,443	A237V	probably damaging	Het
Olfr945	T	A	9: 39,258,034	I213F	possibly damaging	Het
Pbrm1	A	G	14: 31,036,003	T197A	probably benign	Het
Pla2r1	T	A	2: 60,432,593	N1034I	probably damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp1	A	T	3: 79,644,761	D744E	probably benign	Het
Samd9l	T	C	6: 3,376,887	N125D	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Slc22a30	C	T	19: 8,404,545	V121M	probably damaging	Het
Smarcc1	T	A	9: 110,164,829	D247E	possibly damaging	Het
Smg9	T	A	7: 24,420,867	L422Q	probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Utrn	T	A	10: 12,710,171	D954V	probably benign	Het
Vmn1r227	T	A	17: 20,735,516		noncoding transcript	Het
Vmn2r11	A	C	5: 109,054,750		probably null	Het
Vmn2r84	A	T	10: 130,391,369	M200K	probably damaging	Het
Wdcp	A	G	12: 4,855,279	N600S	probably null	Het
Wdfy4	T	G	14: 33,125,880	R838S	possibly damaging	Het

Other mutations in Vmn2r88

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Vmn2r88	APN	14	51413125	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413060	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51413256	missense	probably benign	0.00
IGL00990:Vmn2r88	APN	14	51416802	missense	possibly damaging	0.59
IGL02308:Vmn2r88	APN	14	51417980	missense	possibly damaging	0.96
IGL02481:Vmn2r88	APN	14	51414154	missense	probably benign
IGL02483:Vmn2r88	APN	14	51414154	missense	probably benign
IGL03241:Vmn2r88	APN	14	51418373	missense	probably benign	0.03
R0052:Vmn2r88	UTSW	14	51418700	missense	possibly damaging	0.88
R0070:Vmn2r88	UTSW	14	51414140	missense	probably benign	0.08
R0799:Vmn2r88	UTSW	14	51414502	missense	possibly damaging	0.61
R0906:Vmn2r88	UTSW	14	51418209	missense	probably damaging	1.00
R1322:Vmn2r88	UTSW	14	51414108	missense	probably damaging	1.00
R1352:Vmn2r88	UTSW	14	51418550	missense	probably damaging	1.00
R1639:Vmn2r88	UTSW	14	51416787	missense	probably damaging	0.98
R1780:Vmn2r88	UTSW	14	51418572	missense	probably damaging	1.00
R1834:Vmn2r88	UTSW	14	51413030	splice site	probably benign
R1911:Vmn2r88	UTSW	14	51418214	missense	probably damaging	1.00
R2113:Vmn2r88	UTSW	14	51418194	missense	probably damaging	1.00
R2120:Vmn2r88	UTSW	14	51413208	missense	probably benign	0.00
R2126:Vmn2r88	UTSW	14	51413807	missense	probably benign	0.01
R2348:Vmn2r88	UTSW	14	51414004	missense	probably benign	0.00
R2881:Vmn2r88	UTSW	14	51418689	missense	probably damaging	0.97
R2884:Vmn2r88	UTSW	14	51413934	missense	probably damaging	1.00
R3081:Vmn2r88	UTSW	14	51418632	missense	probably damaging	0.99
R3933:Vmn2r88	UTSW	14	51413978	missense	probably benign	0.44
R3967:Vmn2r88	UTSW	14	51413190	missense	probably benign	0.06
R4378:Vmn2r88	UTSW	14	51413289	nonsense	probably null
R4397:Vmn2r88	UTSW	14	51417978	missense	probably damaging	1.00
R4418:Vmn2r88	UTSW	14	51418081	missense	probably damaging	1.00
R4609:Vmn2r88	UTSW	14	51418074	missense	probably damaging	0.98
R4647:Vmn2r88	UTSW	14	51418793	missense	probably benign	0.02
R4672:Vmn2r88	UTSW	14	51418155	missense	probably damaging	1.00
R4684:Vmn2r88	UTSW	14	51413334	missense	possibly damaging	0.95
R4686:Vmn2r88	UTSW	14	51413339	missense	probably benign	0.03
R4720:Vmn2r88	UTSW	14	51413245	missense	probably benign	0.01
R5046:Vmn2r88	UTSW	14	51413181	missense	probably benign	0.03
R5063:Vmn2r88	UTSW	14	51411146	missense	probably damaging	0.96
R5619:Vmn2r88	UTSW	14	51413910	missense	probably damaging	0.99
R5652:Vmn2r88	UTSW	14	51418572	missense	probably damaging	0.98
R6020:Vmn2r88	UTSW	14	51418149	nonsense	probably null
R6103:Vmn2r88	UTSW	14	51415369	missense	probably benign	0.17
R6674:Vmn2r88	UTSW	14	51414338	missense	probably benign	0.01
R6799:Vmn2r88	UTSW	14	51413969	missense	probably benign	0.05
R7089:Vmn2r88	UTSW	14	51418643	missense
R7104:Vmn2r88	UTSW	14	51413796	missense
R7265:Vmn2r88	UTSW	14	51418319	missense
R7316:Vmn2r88	UTSW	14	51414255	missense
R7552:Vmn2r88	UTSW	14	51410858	splice site	probably null
R7611:Vmn2r88	UTSW	14	51413997	missense
R7667:Vmn2r88	UTSW	14	51417989	missense
R7682:Vmn2r88	UTSW	14	51418449	missense
R7755:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7811:Vmn2r88	UTSW	14	51418703	missense
R7882:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R7957:Vmn2r88	UTSW	14	51413132	missense
R7998:Vmn2r88	UTSW	14	51414108	missense
R8142:Vmn2r88	UTSW	14	51414107	missense
R8186:Vmn2r88	UTSW	14	51418700	missense
R8348:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8448:Vmn2r88	UTSW	14	51418796	missense	probably damaging	0.97
R8483:Vmn2r88	UTSW	14	51413073	missense	possibly damaging	0.48
R8783:Vmn2r88	UTSW	14	51414066	missense
R8859:Vmn2r88	UTSW	14	51418806	missense	probably damaging	0.97
R8916:Vmn2r88	UTSW	14	51411136	missense
R8936:Vmn2r88	UTSW	14	51418526	missense	possibly damaging	0.88
R9004:Vmn2r88	UTSW	14	51413167	missense
R9038:Vmn2r88	UTSW	14	51414033	missense
R9063:Vmn2r88	UTSW	14	51410872	start gained	probably benign
R9311:Vmn2r88	UTSW	14	51413046	missense	probably benign	0.00
R9382:Vmn2r88	UTSW	14	51418740	missense
R9483:Vmn2r88	UTSW	14	51411184	missense
R9602:Vmn2r88	UTSW	14	51413732	missense
V5622:Vmn2r88	UTSW	14	51413127	missense	probably benign
X0024:Vmn2r88	UTSW	14	51413832	missense	possibly damaging	0.79
X0025:Vmn2r88	UTSW	14	51416802	missense	possibly damaging	0.59
Z1177:Vmn2r88	UTSW	14	51418046	frame shift	probably null
Z1177:Vmn2r88	UTSW	14	51418187	missense
Z1190:Vmn2r88	UTSW	14	51413201	missense

Predicted Primers

PCR Primer
(F):5'- ATGGGTTTATTTCACTACAGCTGTC -3'
(R):5'- GGTGCTATTGAACATGCAATCC -3'

Sequencing Primer
(F):5'- ACTACAGCTGTCTATTCTGAAAAATC -3'
(R):5'- GCCCAGATTAACATGCAGTTG -3'

Posted On

2015-05-15