Mutagenetix > Incidental Mutation

Incidental Mutation 'R4091:Carns1'

317643

Institutional Source

Beutler Lab

Gene Symbol

Carns1

Ensembl Gene

ENSMUSG00000075289

Gene Name

carnosine synthase 1

Synonyms

Atpgd1

MMRRC Submission

041626-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R4091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4164324-4175479 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4171683 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 191 (R191Q)

Ref Sequence

ENSEMBL: ENSMUSP00000131624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167055]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000167055
AA Change: R191Q

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131624
Gene: ENSMUSG00000075289
AA Change: R191Q

Domain	Start	End	E-Value	Type
low complexity region	206	217	N/A	INTRINSIC
low complexity region	312	328	N/A	INTRINSIC
low complexity region	332	348	N/A	INTRINSIC
low complexity region	399	410	N/A	INTRINSIC
low complexity region	414	433	N/A	INTRINSIC
low complexity region	490	496	N/A	INTRINSIC
Pfam:ATP-grasp_4	620	819	4.1e-46	PFAM
low complexity region	862	875	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181211

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CARNS1 (EC 6.3.2.11), a member of the ATP-grasp family of ATPases, catalyzes the formation of carnosine (beta-alanyl-L-histidine) and homocarnosine (gamma-aminobutyryl-L-histidine), which are found mainly in skeletal muscle and the central nervous system, respectively (Drozak et al., 2010 [PubMed 20097752]).[supplied by OMIM, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,745,378	S674P	possibly damaging	Het
4932438A13Rik	G	A	3: 37,030,589	A3897T	probably benign	Het
A530099J19Rik	T	A	13: 19,729,465		noncoding transcript	Het
Abca3	C	T	17: 24,397,482	T966M	probably damaging	Het
Adam2	A	T	14: 66,029,723	Y696N	probably damaging	Het
Aes	G	A	10: 81,565,584	G162D	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap25	G	T	6: 87,463,035	S543R	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Casp8ap2	C	A	4: 32,643,611	P895T	probably damaging	Het
Col12a1	T	A	9: 79,702,364	I287F	probably damaging	Het
Cystm1	A	G	18: 36,366,547	N5S	unknown	Het
Dnah8	T	C	17: 30,769,839	V3261A	probably damaging	Het
Dnajc11	A	G	4: 151,978,093		probably benign	Het
Dock4	T	C	12: 40,844,267	S1847P	probably damaging	Het
Dync2h1	A	G	9: 7,131,881	V1642A	probably benign	Het
Eftud2	T	C	11: 102,839,416		probably null	Het
Fam221b	A	G	4: 43,665,987	I208T	probably benign	Het
Gpr37l1	T	C	1: 135,161,563	I255V	probably benign	Het
Grm7	G	A	6: 110,914,340	S178N	probably damaging	Het
Hspa12b	T	A	2: 131,133,488		probably null	Het
Kctd3	A	T	1: 188,995,720		probably benign	Het
Kynu	G	A	2: 43,679,872	V389M	possibly damaging	Het
Lcat	A	G	8: 105,939,906	L328P	probably benign	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Maml1	G	A	11: 50,291,829	P78L	probably benign	Het
Mef2b	G	A	8: 70,165,102	V37M	probably damaging	Het
Mindy2	A	T	9: 70,634,060	M281K	probably damaging	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Mtr	A	T	13: 12,231,057	V394E	probably damaging	Het
Myh14	T	A	7: 44,632,991	T745S	possibly damaging	Het
Nme9	T	A	9: 99,464,527	D131E	possibly damaging	Het
Nphp4	C	A	4: 152,547,018	Q792K	probably damaging	Het
Nrxn2	T	A	19: 6,473,414	C479S	probably damaging	Het
Nsmf	T	C	2: 25,060,859	I406T	probably damaging	Het
Olfr1431	A	T	19: 12,209,779	D71V	probably damaging	Het
Olfr517	G	A	7: 108,868,443	A237V	probably damaging	Het
Olfr945	T	A	9: 39,258,034	I213F	possibly damaging	Het
Pbrm1	A	G	14: 31,036,003	T197A	probably benign	Het
Pla2r1	T	A	2: 60,432,593	N1034I	probably damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp1	A	T	3: 79,644,761	D744E	probably benign	Het
Samd9l	T	C	6: 3,376,887	N125D	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Slc22a30	C	T	19: 8,404,545	V121M	probably damaging	Het
Smarcc1	T	A	9: 110,164,829	D247E	possibly damaging	Het
Smg9	T	A	7: 24,420,867	L422Q	probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Utrn	T	A	10: 12,710,171	D954V	probably benign	Het
Vmn1r227	T	A	17: 20,735,516		noncoding transcript	Het
Vmn2r11	A	C	5: 109,054,750		probably null	Het
Vmn2r84	A	T	10: 130,391,369	M200K	probably damaging	Het
Vmn2r88	T	A	14: 51,415,426	Y469N	probably damaging	Het
Wdcp	A	G	12: 4,855,279	N600S	probably null	Het
Wdfy4	T	G	14: 33,125,880	R838S	possibly damaging	Het

Other mutations in Carns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Carns1	APN	19	4166499	splice site	probably null
IGL02246:Carns1	APN	19	4166432	missense	possibly damaging	0.87
IGL02658:Carns1	APN	19	4173084	missense	probably benign	0.01
IGL02800:Carns1	APN	19	4166570	splice site	probably benign
R1750:Carns1	UTSW	19	4173157	missense	possibly damaging	0.63
R1902:Carns1	UTSW	19	4166338	missense	probably damaging	1.00
R1935:Carns1	UTSW	19	4165474	missense	probably damaging	1.00
R2434:Carns1	UTSW	19	4165449	missense	probably damaging	1.00
R2437:Carns1	UTSW	19	4165783	missense	possibly damaging	0.69
R3772:Carns1	UTSW	19	4170916	splice site	probably benign
R4518:Carns1	UTSW	19	4170070	missense	probably benign	0.05
R4668:Carns1	UTSW	19	4165476	nonsense	probably null
R4737:Carns1	UTSW	19	4170928	intron	probably benign
R4751:Carns1	UTSW	19	4166418	missense	probably damaging	1.00
R5384:Carns1	UTSW	19	4171901	critical splice acceptor site	probably null
R6077:Carns1	UTSW	19	4170876	missense	probably benign	0.01
R6373:Carns1	UTSW	19	4166516	missense	probably benign	0.41
R6411:Carns1	UTSW	19	4166464	missense	probably damaging	1.00
R6470:Carns1	UTSW	19	4171783	missense	possibly damaging	0.85
R6486:Carns1	UTSW	19	4169980	missense	probably benign	0.04
R6915:Carns1	UTSW	19	4169913	missense	probably benign	0.34
R6981:Carns1	UTSW	19	4170082	missense	probably benign	0.00
R7936:Carns1	UTSW	19	4166153	missense	probably benign
R8025:Carns1	UTSW	19	4166506	missense	probably damaging	1.00
R9279:Carns1	UTSW	19	4166257	missense	possibly damaging	0.51
R9711:Carns1	UTSW	19	4166008	missense	possibly damaging	0.94
R9725:Carns1	UTSW	19	4166549	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCCACTGAGTTCCACCAG -3'
(R):5'- CAGGAAACATGCTCCTTTGCC -3'

Sequencing Primer
(F):5'- TGAGTTCCACCAGCCGGAG -3'
(R):5'- TCCCCTGCTTGGCTGATGAAG -3'

Posted On

2015-05-15