Mutagenetix > Incidental Mutations

Incidental Mutation 'R4091:Slc22a30'

317645

Institutional Source

Beutler Lab

Gene Symbol

Slc22a30

Ensembl Gene

ENSMUSG00000052562

Gene Name

solute carrier family 22, member 30

Synonyms

MMRRC Submission

041626-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R4091 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8335371-8405111 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 8404545 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 121 (V121M)

Ref Sequence

ENSEMBL: ENSMUSP00000093988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064507
AA Change: V121M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: V121M

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	439	3.1e-21	PFAM
Pfam:MFS_1	127	433	8.8e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000096269
AA Change: V121M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: V121M

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	527	9.6e-27	PFAM
Pfam:MFS_1	140	376	1.2e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120540
AA Change: V121M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: V121M

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Sugar_tr	99	435	1.3e-20	PFAM
Pfam:MFS_1	127	435	1.5e-19	PFAM

Meta Mutation Damage Score

0.3783

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	T	C	2: 68,745,378	S674P	possibly damaging	Het
4932438A13Rik	G	A	3: 37,030,589	A3897T	probably benign	Het
A530099J19Rik	T	A	13: 19,729,465		noncoding transcript	Het
Abca3	C	T	17: 24,397,482	T966M	probably damaging	Het
Adam2	A	T	14: 66,029,723	Y696N	probably damaging	Het
Aes	G	A	10: 81,565,584	G162D	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Arhgap25	G	T	6: 87,463,035	S543R	probably benign	Het
Bckdk	C	A	7: 127,905,418	R105S	probably damaging	Het
Carns1	C	T	19: 4,171,683	R191Q	probably damaging	Het
Casp8ap2	C	A	4: 32,643,611	P895T	probably damaging	Het
Col12a1	T	A	9: 79,702,364	I287F	probably damaging	Het
Cystm1	A	G	18: 36,366,547	N5S	unknown	Het
Dnah8	T	C	17: 30,769,839	V3261A	probably damaging	Het
Dnajc11	A	G	4: 151,978,093		probably benign	Het
Dock4	T	C	12: 40,844,267	S1847P	probably damaging	Het
Dync2h1	A	G	9: 7,131,881	V1642A	probably benign	Het
Eftud2	T	C	11: 102,839,416		probably null	Het
Fam221b	A	G	4: 43,665,987	I208T	probably benign	Het
Gpr37l1	T	C	1: 135,161,563	I255V	probably benign	Het
Grm7	G	A	6: 110,914,340	S178N	probably damaging	Het
Hspa12b	T	A	2: 131,133,488		probably null	Het
Kctd3	A	T	1: 188,995,720		probably benign	Het
Kynu	G	A	2: 43,679,872	V389M	possibly damaging	Het
Lcat	A	G	8: 105,939,906	L328P	probably benign	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Maml1	G	A	11: 50,291,829	P78L	probably benign	Het
Mef2b	G	A	8: 70,165,102	V37M	probably damaging	Het
Mindy2	A	T	9: 70,634,060	M281K	probably damaging	Het
Mon2	C	T	10: 123,038,510	R311H	probably damaging	Het
Mtr	A	T	13: 12,231,057	V394E	probably damaging	Het
Myh14	T	A	7: 44,632,991	T745S	possibly damaging	Het
Nme9	T	A	9: 99,464,527	D131E	possibly damaging	Het
Nphp4	C	A	4: 152,547,018	Q792K	probably damaging	Het
Nrxn2	T	A	19: 6,473,414	C479S	probably damaging	Het
Nsmf	T	C	2: 25,060,859	I406T	probably damaging	Het
Olfr1431	A	T	19: 12,209,779	D71V	probably damaging	Het
Olfr517	G	A	7: 108,868,443	A237V	probably damaging	Het
Olfr945	T	A	9: 39,258,034	I213F	possibly damaging	Het
Pbrm1	A	G	14: 31,036,003	T197A	probably benign	Het
Pla2r1	T	A	2: 60,432,593	N1034I	probably damaging	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp1	A	T	3: 79,644,761	D744E	probably benign	Het
Samd9l	T	C	6: 3,376,887	N125D	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Smarcc1	T	A	9: 110,164,829	D247E	possibly damaging	Het
Smg9	T	A	7: 24,420,867	L422Q	probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Utrn	T	A	10: 12,710,171	D954V	probably benign	Het
Vmn1r227	T	A	17: 20,735,516		noncoding transcript	Het
Vmn2r11	A	C	5: 109,054,750		probably null	Het
Vmn2r84	A	T	10: 130,391,369	M200K	probably damaging	Het
Vmn2r88	T	A	14: 51,415,426	Y469N	probably damaging	Het
Wdcp	A	G	12: 4,855,279	N600S	probably null	Het
Wdfy4	T	G	14: 33,125,880	R838S	possibly damaging	Het

Other mutations in Slc22a30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Slc22a30	APN	19	8335788	missense	probably benign	0.29
IGL01894:Slc22a30	APN	19	8386657	missense	probably benign	0.28
IGL02795:Slc22a30	APN	19	8400895	missense	probably damaging	1.00
IGL02798:Slc22a30	APN	19	8370085	missense	probably damaging	0.96
IGL03267:Slc22a30	APN	19	8337958	missense	probably benign	0.00
R0089:Slc22a30	UTSW	19	8370197	missense	probably benign	0.03
R0243:Slc22a30	UTSW	19	8345357	missense	probably benign	0.01
R1033:Slc22a30	UTSW	19	8335801	nonsense	probably null
R1781:Slc22a30	UTSW	19	8335772	missense	probably damaging	1.00
R2098:Slc22a30	UTSW	19	8400811	missense	probably damaging	1.00
R3874:Slc22a30	UTSW	19	8336849	missense	probably benign	0.31
R4799:Slc22a30	UTSW	19	8344404	missense	probably benign
R5108:Slc22a30	UTSW	19	8386426	missense	probably damaging	1.00
R5191:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5192:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5193:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5195:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5253:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5254:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5255:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5256:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5377:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5378:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5400:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5401:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5481:Slc22a30	UTSW	19	8336837	missense	probably benign	0.01
R5644:Slc22a30	UTSW	19	8404616	missense	possibly damaging	0.72
R5679:Slc22a30	UTSW	19	8335771	missense	possibly damaging	0.90
R5699:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5704:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5706:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5767:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5770:Slc22a30	UTSW	19	8386527	missense	probably damaging	0.99
R5784:Slc22a30	UTSW	19	8344393	nonsense	probably null
R5793:Slc22a30	UTSW	19	8336819	missense	possibly damaging	0.95
R5813:Slc22a30	UTSW	19	8404581	missense	probably benign	0.07
R6101:Slc22a30	UTSW	19	8337868	splice site	probably null
R6105:Slc22a30	UTSW	19	8337868	splice site	probably null
R6327:Slc22a30	UTSW	19	8335722	utr 3 prime	probably benign
R6958:Slc22a30	UTSW	19	8386701	missense	probably damaging	0.98
R7162:Slc22a30	UTSW	19	8336717	splice site	probably null
R7375:Slc22a30	UTSW	19	8404691	missense	probably damaging	1.00
R7572:Slc22a30	UTSW	19	8335708	missense	unknown
R7755:Slc22a30	UTSW	19	8336769	missense	probably damaging	1.00
R8114:Slc22a30	UTSW	19	8404540	nonsense	probably null
R8248:Slc22a30	UTSW	19	8370199	missense	probably benign	0.12
Z1088:Slc22a30	UTSW	19	8335775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGGCTGAATAACACTGTCTTGTC -3'
(R):5'- GATCCTGAGCCAAGATGACC -3'

Sequencing Primer
(F):5'- CTTATTGCCATGACAAGGGACCTG -3'
(R):5'- TGAGCCAAGATGACCTCCTGAG -3'

Posted On

2015-05-15