Incidental Mutation 'R4091:Olfr1431'
ID317646
Institutional Source Beutler Lab
Gene Symbol Olfr1431
Ensembl Gene ENSMUSG00000094133
Gene Nameolfactory receptor 1431
SynonymsGA_x6K02T2RE5P-2573738-2574676, MOR214-5
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4091 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12200634-12212191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12209779 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 71 (D71V)
Ref Sequence ENSEMBL: ENSMUSP00000150967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072316] [ENSMUST00000213759]
Predicted Effect probably damaging
Transcript: ENSMUST00000072316
AA Change: D71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072158
Gene: ENSMUSG00000094133
AA Change: D71V

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.4e-56 PFAM
Pfam:7tm_1 42 309 2.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213759
AA Change: D71V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214138
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,745,378 S674P possibly damaging Het
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in Olfr1431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Olfr1431 APN 19 12210040 missense possibly damaging 0.65
IGL02206:Olfr1431 APN 19 12210460 missense probably damaging 1.00
IGL02938:Olfr1431 APN 19 12209682 missense probably benign 0.00
PIT4812001:Olfr1431 UTSW 19 12210253 missense probably damaging 1.00
R0402:Olfr1431 UTSW 19 12209589 missense probably damaging 1.00
R0661:Olfr1431 UTSW 19 12209704 missense probably damaging 1.00
R1193:Olfr1431 UTSW 19 12210439 missense probably damaging 1.00
R1483:Olfr1431 UTSW 19 12209750 nonsense probably null
R4280:Olfr1431 UTSW 19 12209938 missense probably damaging 1.00
R5028:Olfr1431 UTSW 19 12210154 missense possibly damaging 0.94
R5540:Olfr1431 UTSW 19 12210460 missense probably damaging 1.00
R6042:Olfr1431 UTSW 19 12209922 missense probably damaging 0.99
R6045:Olfr1431 UTSW 19 12210295 missense probably damaging 1.00
R7104:Olfr1431 UTSW 19 12209878 missense possibly damaging 0.82
Z1088:Olfr1431 UTSW 19 12210490 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTAGGAGCACTAGCACTGAAG -3'
(R):5'- CAAATGGCAGCATACCTGTC -3'

Sequencing Primer
(F):5'- AATAACCCAGTTCATCCTCCTGG -3'
(R):5'- CTGTCATAGGCCATGGCTGTC -3'
Posted On2015-05-15