Incidental Mutation 'R4092:Tollip'
ID317669
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Nametoll interacting protein
Synonyms4930403G24Rik, Toll interacting protein, 4931428G15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4092 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141874813-141918507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141884443 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 181 (R181H)
Ref Sequence ENSEMBL: ENSMUSP00000118336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
Predicted Effect probably damaging
Transcript: ENSMUST00000001950
AA Change: R250H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: R250H

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055819
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130439
AA Change: R246H

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: R246H

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151890
AA Change: R181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: R181H

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Meta Mutation Damage Score 0.3541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,293,273 H340Q probably benign Het
2900011O08Rik G A 16: 14,049,482 R68H probably damaging Het
Adam22 A T 5: 8,095,004 I116N probably damaging Het
Adamts2 T A 11: 50,787,276 V794E probably damaging Het
Ak9 T C 10: 41,389,144 S966P probably benign Het
Alox5 G A 6: 116,412,674 probably benign Het
Brip1 C T 11: 86,148,521 D396N possibly damaging Het
Catsper3 C T 13: 55,784,671 H4Y probably benign Het
Cmtm2a T C 8: 104,292,771 Y62C probably benign Het
Crim1 T C 17: 78,350,836 C715R probably damaging Het
Dio3 A G 12: 110,279,800 D190G possibly damaging Het
Efl1 A G 7: 82,762,827 E808G probably benign Het
Fam196b G A 11: 34,401,935 probably benign Het
Fam83b T C 9: 76,491,661 D720G probably benign Het
Fbp2 C T 13: 62,840,360 V246M possibly damaging Het
Gm10197 G A 19: 53,371,765 probably benign Het
Gm6803 A T 12: 88,018,424 N116K possibly damaging Het
Icam2 C A 11: 106,380,797 M1I probably null Het
Kit T C 5: 75,610,810 I209T probably benign Het
Lcmt1 T C 7: 123,418,253 V200A probably damaging Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Mmadhc A G 2: 50,287,883 M174T probably benign Het
N4bp2 A G 5: 65,790,456 N143S probably benign Het
Ndufs1 G A 1: 63,157,246 A340V possibly damaging Het
Nid1 A G 13: 13,486,639 D708G probably damaging Het
Noc2l A C 4: 156,242,576 T295P probably damaging Het
Nutm1 T A 2: 112,249,464 N702I probably damaging Het
Obscn T A 11: 59,056,060 M4083L probably benign Het
Olfr1457 T C 19: 13,095,426 Y74C probably damaging Het
Otol1 T A 3: 70,027,785 I370N probably damaging Het
Paip1 T G 13: 119,449,913 S58A probably benign Het
Pfas T C 11: 68,993,949 T476A probably benign Het
Plppr3 G T 10: 79,867,480 R57S probably damaging Het
Ptgir T C 7: 16,907,007 S75P probably damaging Het
Raver1 A T 9: 21,081,272 L287Q probably damaging Het
Rps6ka4 C T 19: 6,832,255 probably null Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a T A 9: 119,789,970 M769L probably benign Het
Serpina16 G T 12: 103,672,577 H250Q probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc12a8 G A 16: 33,617,121 G308D probably damaging Het
Slfn5 T C 11: 82,961,067 L673P probably damaging Het
Sorcs2 T C 5: 36,025,822 K1036E possibly damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sptbn5 C A 2: 120,067,051 E550D probably damaging Het
Srgap3 G T 6: 112,723,084 P1002T probably benign Het
Trmt1l T A 1: 151,455,033 S600R probably benign Het
Vps16 T A 2: 130,439,912 Y315N probably damaging Het
Vps50 A G 6: 3,551,037 E367G probably benign Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R5192:Tollip UTSW 7 141892117 missense probably damaging 1.00
R5614:Tollip UTSW 7 141892088 missense probably damaging 1.00
R6132:Tollip UTSW 7 141889597 missense probably benign 0.37
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R6830:Tollip UTSW 7 141898714 start codon destroyed probably null 0.00
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R7759:Tollip UTSW 7 141884539 missense probably benign
R8024:Tollip UTSW 7 141892826 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGACTGCCTGCTTAGAACC -3'
(R):5'- GCAGCTTTGTGATCCCACTG -3'

Sequencing Primer
(F):5'- TGCATCCCCGAAATATGTAGG -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2015-05-15