Incidental Mutation 'R4092:Scn11a'
ID317676
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4092 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119789970 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 769 (M769L)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably benign
Transcript: ENSMUST00000070617
AA Change: M769L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: M769L

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215718
AA Change: M769L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,293,273 H340Q probably benign Het
2900011O08Rik G A 16: 14,049,482 R68H probably damaging Het
Adam22 A T 5: 8,095,004 I116N probably damaging Het
Adamts2 T A 11: 50,787,276 V794E probably damaging Het
Ak9 T C 10: 41,389,144 S966P probably benign Het
Alox5 G A 6: 116,412,674 probably benign Het
Brip1 C T 11: 86,148,521 D396N possibly damaging Het
Catsper3 C T 13: 55,784,671 H4Y probably benign Het
Cmtm2a T C 8: 104,292,771 Y62C probably benign Het
Crim1 T C 17: 78,350,836 C715R probably damaging Het
Dio3 A G 12: 110,279,800 D190G possibly damaging Het
Efl1 A G 7: 82,762,827 E808G probably benign Het
Fam196b G A 11: 34,401,935 probably benign Het
Fam83b T C 9: 76,491,661 D720G probably benign Het
Fbp2 C T 13: 62,840,360 V246M possibly damaging Het
Gm10197 G A 19: 53,371,765 probably benign Het
Gm6803 A T 12: 88,018,424 N116K possibly damaging Het
Icam2 C A 11: 106,380,797 M1I probably null Het
Kit T C 5: 75,610,810 I209T probably benign Het
Lcmt1 T C 7: 123,418,253 V200A probably damaging Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Mmadhc A G 2: 50,287,883 M174T probably benign Het
N4bp2 A G 5: 65,790,456 N143S probably benign Het
Ndufs1 G A 1: 63,157,246 A340V possibly damaging Het
Nid1 A G 13: 13,486,639 D708G probably damaging Het
Noc2l A C 4: 156,242,576 T295P probably damaging Het
Nutm1 T A 2: 112,249,464 N702I probably damaging Het
Obscn T A 11: 59,056,060 M4083L probably benign Het
Olfr1457 T C 19: 13,095,426 Y74C probably damaging Het
Otol1 T A 3: 70,027,785 I370N probably damaging Het
Paip1 T G 13: 119,449,913 S58A probably benign Het
Pfas T C 11: 68,993,949 T476A probably benign Het
Plppr3 G T 10: 79,867,480 R57S probably damaging Het
Ptgir T C 7: 16,907,007 S75P probably damaging Het
Raver1 A T 9: 21,081,272 L287Q probably damaging Het
Rps6ka4 C T 19: 6,832,255 probably null Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Serpina16 G T 12: 103,672,577 H250Q probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc12a8 G A 16: 33,617,121 G308D probably damaging Het
Slfn5 T C 11: 82,961,067 L673P probably damaging Het
Sorcs2 T C 5: 36,025,822 K1036E possibly damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sptbn5 C A 2: 120,067,051 E550D probably damaging Het
Srgap3 G T 6: 112,723,084 P1002T probably benign Het
Tollip C T 7: 141,884,443 R181H probably damaging Het
Trmt1l T A 1: 151,455,033 S600R probably benign Het
Vps16 T A 2: 130,439,912 Y315N probably damaging Het
Vps50 A G 6: 3,551,037 E367G probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATAACAATGCTCACTAGTGAAG -3'
(R):5'- GTCCTAACGATCGTGGTCTTCATC -3'

Sequencing Primer
(F):5'- GAGTTGCTCCTGGTAAATTAGCCAC -3'
(R):5'- AACGATCGTGGTCTTCATCTTTTC -3'
Posted On2015-05-15