Mutagenetix > Incidental Mutations

Incidental Mutation 'R4092:Scn11a'

317676

Institutional Source

Beutler Lab

Gene Symbol

Scn11a

Ensembl Gene

ENSMUSG00000034115

Gene Name

sodium channel, voltage-gated, type XI, alpha

Synonyms

NaN, NSS2, NaT, SNS2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R4092 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119753759-119825456 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119789970 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 769 (M769L)

Ref Sequence

ENSEMBL: ENSMUSP00000149420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]

Predicted Effect

probably benign
Transcript: ENSMUST00000070617
AA Change: M769L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: M769L

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:Ion_trans	128	409	1.1e-72	PFAM
low complexity region	475	487	N/A	INTRINSIC
Pfam:Ion_trans	574	810	4e-57	PFAM
Pfam:Na_trans_assoc	814	1030	4.1e-29	PFAM
Pfam:Ion_trans	1034	1300	5.7e-66	PFAM
Pfam:Ion_trans	1346	1595	3e-58	PFAM
low complexity region	1683	1694	N/A	INTRINSIC
low complexity region	1733	1744	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215718
AA Change: M769L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010315B03Rik	A	T	9: 124,293,273	H340Q	probably benign	Het
2900011O08Rik	G	A	16: 14,049,482	R68H	probably damaging	Het
Adam22	A	T	5: 8,095,004	I116N	probably damaging	Het
Adamts2	T	A	11: 50,787,276	V794E	probably damaging	Het
Ak9	T	C	10: 41,389,144	S966P	probably benign	Het
Alox5	G	A	6: 116,412,674		probably benign	Het
Brip1	C	T	11: 86,148,521	D396N	possibly damaging	Het
Catsper3	C	T	13: 55,784,671	H4Y	probably benign	Het
Cmtm2a	T	C	8: 104,292,771	Y62C	probably benign	Het
Crim1	T	C	17: 78,350,836	C715R	probably damaging	Het
Dio3	A	G	12: 110,279,800	D190G	possibly damaging	Het
Efl1	A	G	7: 82,762,827	E808G	probably benign	Het
Fam196b	G	A	11: 34,401,935		probably benign	Het
Fam83b	T	C	9: 76,491,661	D720G	probably benign	Het
Fbp2	C	T	13: 62,840,360	V246M	possibly damaging	Het
Gm10197	G	A	19: 53,371,765		probably benign	Het
Gm6803	A	T	12: 88,018,424	N116K	possibly damaging	Het
Icam2	C	A	11: 106,380,797	M1I	probably null	Het
Kit	T	C	5: 75,610,810	I209T	probably benign	Het
Lcmt1	T	C	7: 123,418,253	V200A	probably damaging	Het
Lrrn2	C	T	1: 132,937,652	Q152*	probably null	Het
Mmadhc	A	G	2: 50,287,883	M174T	probably benign	Het
N4bp2	A	G	5: 65,790,456	N143S	probably benign	Het
Ndufs1	G	A	1: 63,157,246	A340V	possibly damaging	Het
Nid1	A	G	13: 13,486,639	D708G	probably damaging	Het
Noc2l	A	C	4: 156,242,576	T295P	probably damaging	Het
Nutm1	T	A	2: 112,249,464	N702I	probably damaging	Het
Obscn	T	A	11: 59,056,060	M4083L	probably benign	Het
Olfr1457	T	C	19: 13,095,426	Y74C	probably damaging	Het
Otol1	T	A	3: 70,027,785	I370N	probably damaging	Het
Paip1	T	G	13: 119,449,913	S58A	probably benign	Het
Pfas	T	C	11: 68,993,949	T476A	probably benign	Het
Plppr3	G	T	10: 79,867,480	R57S	probably damaging	Het
Ptgir	T	C	7: 16,907,007	S75P	probably damaging	Het
Raver1	A	T	9: 21,081,272	L287Q	probably damaging	Het
Rps6ka4	C	T	19: 6,832,255		probably null	Het
Rps6-ps2	A	G	8: 88,806,691		noncoding transcript	Het
Serpina16	G	T	12: 103,672,577	H250Q	probably benign	Het
Serpina3a	G	A	12: 104,116,366	V133I	probably benign	Het
Slc12a8	G	A	16: 33,617,121	G308D	probably damaging	Het
Slfn5	T	C	11: 82,961,067	L673P	probably damaging	Het
Sorcs2	T	C	5: 36,025,822	K1036E	possibly damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Sptbn5	C	A	2: 120,067,051	E550D	probably damaging	Het
Srgap3	G	T	6: 112,723,084	P1002T	probably benign	Het
Tollip	C	T	7: 141,884,443	R181H	probably damaging	Het
Trmt1l	T	A	1: 151,455,033	S600R	probably benign	Het
Vps16	T	A	2: 130,439,912	Y315N	probably damaging	Het
Vps50	A	G	6: 3,551,037	E367G	probably benign	Het

Other mutations in Scn11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Scn11a	APN	9	119770506	missense	probably benign	0.00
IGL00272:Scn11a	APN	9	119816603	missense	probably damaging	0.98
IGL00332:Scn11a	APN	9	119769916	missense	probably damaging	1.00
IGL00533:Scn11a	APN	9	119774381	missense	probably damaging	1.00
IGL00972:Scn11a	APN	9	119793938	missense	probably benign	0.44
IGL01338:Scn11a	APN	9	119784161	splice site	probably benign
IGL01534:Scn11a	APN	9	119780822	missense	probably benign	0.27
IGL01838:Scn11a	APN	9	119758583	missense	probably damaging	1.00
IGL01991:Scn11a	APN	9	119819904	missense	probably damaging	0.97
IGL02057:Scn11a	APN	9	119765470	missense	probably damaging	1.00
IGL02290:Scn11a	APN	9	119774442	missense	probably damaging	0.97
IGL02454:Scn11a	APN	9	119758544	missense	probably benign	0.00
IGL02517:Scn11a	APN	9	119792398	missense	probably damaging	1.00
IGL02567:Scn11a	APN	9	119804489	missense	probably damaging	0.99
IGL02587:Scn11a	APN	9	119805684	missense	probably damaging	1.00
IGL03069:Scn11a	APN	9	119789963	missense	probably benign	0.16
IGL03171:Scn11a	APN	9	119819847	missense	probably benign	0.00
Kleinie	UTSW	9	119803503	missense	probably benign	0.16
H8441:Scn11a	UTSW	9	119807910	missense	probably damaging	1.00
PIT4449001:Scn11a	UTSW	9	119769948	missense	probably damaging	1.00
R0304:Scn11a	UTSW	9	119819862	missense	probably benign	0.00
R0519:Scn11a	UTSW	9	119790119	missense	probably damaging	1.00
R0658:Scn11a	UTSW	9	119811160	missense	probably benign	0.41
R0828:Scn11a	UTSW	9	119755007	missense	probably benign	0.00
R0893:Scn11a	UTSW	9	119803330	splice site	probably null
R0932:Scn11a	UTSW	9	119807810	missense	probably damaging	1.00
R1061:Scn11a	UTSW	9	119795663	missense	probably damaging	0.98
R1161:Scn11a	UTSW	9	119755057	nonsense	probably null
R1162:Scn11a	UTSW	9	119805644	splice site	probably benign
R1310:Scn11a	UTSW	9	119755057	nonsense	probably null
R1589:Scn11a	UTSW	9	119769807	missense	probably damaging	1.00
R1681:Scn11a	UTSW	9	119804412	missense	possibly damaging	0.46
R1781:Scn11a	UTSW	9	119755082	missense	probably damaging	1.00
R1812:Scn11a	UTSW	9	119780865	nonsense	probably null
R1901:Scn11a	UTSW	9	119779036	nonsense	probably null
R1978:Scn11a	UTSW	9	119780795	nonsense	probably null
R1985:Scn11a	UTSW	9	119754678	missense	probably benign	0.19
R2022:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2072:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2098:Scn11a	UTSW	9	119792494	missense	possibly damaging	0.67
R2163:Scn11a	UTSW	9	119755025	missense	probably damaging	1.00
R2250:Scn11a	UTSW	9	119758602	missense	probably benign	0.01
R2373:Scn11a	UTSW	9	119813186	missense	probably benign	0.43
R2508:Scn11a	UTSW	9	119765529	missense	probably damaging	1.00
R3757:Scn11a	UTSW	9	119803503	missense	probably benign	0.16
R3767:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R3770:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R4089:Scn11a	UTSW	9	119795653	splice site	probably null
R4247:Scn11a	UTSW	9	119807886	missense	probably damaging	1.00
R4279:Scn11a	UTSW	9	119754362	missense	probably benign	0.25
R4299:Scn11a	UTSW	9	119765506	missense	probably damaging	0.97
R4403:Scn11a	UTSW	9	119795667	missense	probably damaging	1.00
R4468:Scn11a	UTSW	9	119754987	missense	probably damaging	1.00
R4542:Scn11a	UTSW	9	119755134	missense	probably damaging	1.00
R4644:Scn11a	UTSW	9	119815203	splice site	probably null
R4739:Scn11a	UTSW	9	119754561	missense	probably benign	0.39
R4809:Scn11a	UTSW	9	119819870	missense	probably benign	0.00
R4954:Scn11a	UTSW	9	119758659	missense	possibly damaging	0.84
R5012:Scn11a	UTSW	9	119780878	missense	probably benign	0.31
R5044:Scn11a	UTSW	9	119819831	missense	probably damaging	0.98
R5222:Scn11a	UTSW	9	119815202	splice site	probably null
R5224:Scn11a	UTSW	9	119754792	missense	probably damaging	1.00
R5400:Scn11a	UTSW	9	119769908	missense	probably damaging	0.97
R5555:Scn11a	UTSW	9	119755238	missense	probably damaging	1.00
R5711:Scn11a	UTSW	9	119789924	missense	probably damaging	1.00
R5950:Scn11a	UTSW	9	119811124	missense	probably damaging	1.00
R5984:Scn11a	UTSW	9	119784016	missense	probably benign
R6057:Scn11a	UTSW	9	119765448	missense	probably damaging	1.00
R6104:Scn11a	UTSW	9	119795678	missense	probably damaging	1.00
R6180:Scn11a	UTSW	9	119754867	missense	probably benign	0.00
R6892:Scn11a	UTSW	9	119806969	missense	possibly damaging	0.53
R6908:Scn11a	UTSW	9	119792426	missense	probably damaging	1.00
R6949:Scn11a	UTSW	9	119765514	missense	probably benign	0.04
R7112:Scn11a	UTSW	9	119754809	missense	probably damaging	1.00
R7232:Scn11a	UTSW	9	119759916	missense	probably damaging	1.00
R7261:Scn11a	UTSW	9	119819833	missense	probably damaging	0.99
R7265:Scn11a	UTSW	9	119815265	missense	probably damaging	1.00
R7302:Scn11a	UTSW	9	119806951	missense	probably benign	0.03
R7391:Scn11a	UTSW	9	119795717	missense	probably damaging	1.00
R7441:Scn11a	UTSW	9	119758626	missense	probably benign	0.01
R7479:Scn11a	UTSW	9	119759875	missense	probably benign	0.38
R7768:Scn11a	UTSW	9	119815272	missense	probably benign	0.13
R7785:Scn11a	UTSW	9	119816556	missense	probably benign	0.00
R7794:Scn11a	UTSW	9	119765514	missense	probably damaging	0.99
R7818:Scn11a	UTSW	9	119784111	missense	probably damaging	0.97
Z1088:Scn11a	UTSW	9	119755242	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAATAACAATGCTCACTAGTGAAG -3'
(R):5'- GTCCTAACGATCGTGGTCTTCATC -3'

Sequencing Primer
(F):5'- GAGTTGCTCCTGGTAAATTAGCCAC -3'
(R):5'- AACGATCGTGGTCTTCATCTTTTC -3'

Posted On

2015-05-15