Incidental Mutation 'R4092:Catsper3'
ID317691
Institutional Source Beutler Lab
Gene Symbol Catsper3
Ensembl Gene ENSMUSG00000021499
Gene Namecation channel, sperm associated 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4092 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55784568-55808998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55784671 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 4 (H4Y)
Ref Sequence ENSEMBL: ENSMUSP00000105524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021961] [ENSMUST00000109898]
Predicted Effect probably benign
Transcript: ENSMUST00000021961
AA Change: H4Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021961
Gene: ENSMUSG00000021499
AA Change: H4Y

DomainStartEndE-ValueType
Pfam:Ion_trans 49 277 1.8e-33 PFAM
Pfam:PKD_channel 144 273 5e-7 PFAM
coiled coil region 283 311 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109898
AA Change: H4Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105524
Gene: ENSMUSG00000021499
AA Change: H4Y

DomainStartEndE-ValueType
Pfam:Ion_trans 72 254 4.9e-32 PFAM
Pfam:PKD_channel 125 261 2.1e-7 PFAM
coiled coil region 270 298 N/A INTRINSIC
low complexity region 374 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154384
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for this mutation are viable and exhibit no gross physical or behavioral abnormality. Although wild-type and homozygous mutant females bred to wild-type males exhibit similar fertility, male homozygotes are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik A T 9: 124,293,273 H340Q probably benign Het
2900011O08Rik G A 16: 14,049,482 R68H probably damaging Het
Adam22 A T 5: 8,095,004 I116N probably damaging Het
Adamts2 T A 11: 50,787,276 V794E probably damaging Het
Ak9 T C 10: 41,389,144 S966P probably benign Het
Alox5 G A 6: 116,412,674 probably benign Het
Brip1 C T 11: 86,148,521 D396N possibly damaging Het
Cmtm2a T C 8: 104,292,771 Y62C probably benign Het
Crim1 T C 17: 78,350,836 C715R probably damaging Het
Dio3 A G 12: 110,279,800 D190G possibly damaging Het
Efl1 A G 7: 82,762,827 E808G probably benign Het
Fam196b G A 11: 34,401,935 probably benign Het
Fam83b T C 9: 76,491,661 D720G probably benign Het
Fbp2 C T 13: 62,840,360 V246M possibly damaging Het
Gm10197 G A 19: 53,371,765 probably benign Het
Gm6803 A T 12: 88,018,424 N116K possibly damaging Het
Icam2 C A 11: 106,380,797 M1I probably null Het
Kit T C 5: 75,610,810 I209T probably benign Het
Lcmt1 T C 7: 123,418,253 V200A probably damaging Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Mmadhc A G 2: 50,287,883 M174T probably benign Het
N4bp2 A G 5: 65,790,456 N143S probably benign Het
Ndufs1 G A 1: 63,157,246 A340V possibly damaging Het
Nid1 A G 13: 13,486,639 D708G probably damaging Het
Noc2l A C 4: 156,242,576 T295P probably damaging Het
Nutm1 T A 2: 112,249,464 N702I probably damaging Het
Obscn T A 11: 59,056,060 M4083L probably benign Het
Olfr1457 T C 19: 13,095,426 Y74C probably damaging Het
Otol1 T A 3: 70,027,785 I370N probably damaging Het
Paip1 T G 13: 119,449,913 S58A probably benign Het
Pfas T C 11: 68,993,949 T476A probably benign Het
Plppr3 G T 10: 79,867,480 R57S probably damaging Het
Ptgir T C 7: 16,907,007 S75P probably damaging Het
Raver1 A T 9: 21,081,272 L287Q probably damaging Het
Rps6ka4 C T 19: 6,832,255 probably null Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a T A 9: 119,789,970 M769L probably benign Het
Serpina16 G T 12: 103,672,577 H250Q probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc12a8 G A 16: 33,617,121 G308D probably damaging Het
Slfn5 T C 11: 82,961,067 L673P probably damaging Het
Sorcs2 T C 5: 36,025,822 K1036E possibly damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Sptbn5 C A 2: 120,067,051 E550D probably damaging Het
Srgap3 G T 6: 112,723,084 P1002T probably benign Het
Tollip C T 7: 141,884,443 R181H probably damaging Het
Trmt1l T A 1: 151,455,033 S600R probably benign Het
Vps16 T A 2: 130,439,912 Y315N probably damaging Het
Vps50 A G 6: 3,551,037 E367G probably benign Het
Other mutations in Catsper3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Catsper3 APN 13 55798822 missense possibly damaging 0.94
IGL01794:Catsper3 APN 13 55798906 missense possibly damaging 0.84
IGL02419:Catsper3 APN 13 55808068 missense possibly damaging 0.94
IGL03108:Catsper3 APN 13 55808035 missense probably benign 0.01
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R1870:Catsper3 UTSW 13 55805748 missense probably damaging 1.00
R2229:Catsper3 UTSW 13 55808054 missense probably damaging 1.00
R3055:Catsper3 UTSW 13 55808896 missense unknown
R3056:Catsper3 UTSW 13 55808896 missense unknown
R4113:Catsper3 UTSW 13 55786370 missense probably damaging 0.99
R5197:Catsper3 UTSW 13 55808176 critical splice donor site probably null
R6011:Catsper3 UTSW 13 55786492 missense probably damaging 0.96
R6064:Catsper3 UTSW 13 55806252 missense probably damaging 0.99
R6385:Catsper3 UTSW 13 55786426 missense probably damaging 0.99
R6966:Catsper3 UTSW 13 55798859 missense probably damaging 0.98
R7128:Catsper3 UTSW 13 55798849 missense probably benign 0.00
R7373:Catsper3 UTSW 13 55808132 missense possibly damaging 0.87
R7565:Catsper3 UTSW 13 55784725 missense probably benign 0.10
Z1088:Catsper3 UTSW 13 55808104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTAGTGACAGCTAGAATGCC -3'
(R):5'- TCCAGAGAGACTAGCGTGTCTG -3'

Sequencing Primer
(F):5'- GCTAGAATGCCTAAGAGCGACCTC -3'
(R):5'- GAGACAAGCCCTTCTATCTTGGG -3'
Posted On2015-05-15