Incidental Mutation 'R4093:Wfs1'
ID317718
Institutional Source Beutler Lab
Gene Symbol Wfs1
Ensembl Gene ENSMUSG00000039474
Gene Namewolframin ER transmembrane glycoprotein
Synonymswolframin
MMRRC Submission 041627-MU
Accession Numbers

Genbank: NM_011716; MGI: 1328355

Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R4093 (G1)
Quality Score212
Status Validated
Chromosome5
Chromosomal Location36966104-36989205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36967465 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 694 (H694R)
Ref Sequence ENSEMBL: ENSMUSP00000048053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043964] [ENSMUST00000166339]
Predicted Effect probably damaging
Transcript: ENSMUST00000043964
AA Change: H694R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048053
Gene: ENSMUSG00000039474
AA Change: H694R

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 1e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
transmembrane domain 313 335 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
transmembrane domain 495 517 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 561 583 N/A INTRINSIC
transmembrane domain 590 612 N/A INTRINSIC
transmembrane domain 632 654 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166339
AA Change: H618R

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132404
Gene: ENSMUSG00000039474
AA Change: H618R

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 50 67 N/A INTRINSIC
Blast:SEL1 101 139 3e-8 BLAST
low complexity region 268 275 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
transmembrane domain 419 441 N/A INTRINSIC
transmembrane domain 453 475 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 556 578 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167937
SMART Domains Protein: ENSMUSP00000125779
Gene: ENSMUSG00000039474

DomainStartEndE-ValueType
Blast:SEL1 20 58 4e-9 BLAST
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein, which is located primarily in the endoplasmic reticulum and ubiquitously expressed with highest levels in brain, pancreas, heart, and insulinoma beta-cell lines. Mutations in this gene are associated with Wolfram syndrome, also called DIDMOAD (Diabetes Insipidus, Diabetes Mellitus, Optic Atrophy, and Deafness), an autosomal recessive disorder. The disease affects the brain and central nervous system. Mutations in this gene can also cause autosomal dominant deafness 6 (DFNA6), also known as DFNA14 or DFNA38. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased pancreatic beta cells and impaired glucose tolerance. Mice homozygous for a knock-out allele exhibit impaired glucose tolerance, decreased body weight, and abnormal behavior associated with increased sensitivity to stress. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Wfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Wfs1 APN 5 36967917 nonsense probably null
IGL01391:Wfs1 APN 5 36971563 missense probably benign 0.10
IGL01788:Wfs1 APN 5 36968636 missense probably benign 0.01
IGL02169:Wfs1 APN 5 36968479 missense probably damaging 0.99
IGL02814:Wfs1 APN 5 36967669 missense possibly damaging 0.88
IGL03294:Wfs1 APN 5 36975597 missense probably damaging 1.00
IGL03299:Wfs1 APN 5 36968387 nonsense probably null
2107:Wfs1 UTSW 5 36967273 missense probably damaging 1.00
R0077:Wfs1 UTSW 5 36973194 missense probably damaging 1.00
R0180:Wfs1 UTSW 5 36967028 missense probably damaging 0.96
R0402:Wfs1 UTSW 5 36976980 unclassified probably benign
R0458:Wfs1 UTSW 5 36968669 missense probably damaging 0.98
R0533:Wfs1 UTSW 5 36973722 splice site probably benign
R0890:Wfs1 UTSW 5 36975544 missense probably damaging 1.00
R0948:Wfs1 UTSW 5 36967561 missense probably damaging 1.00
R1413:Wfs1 UTSW 5 36982078 missense possibly damaging 0.65
R1759:Wfs1 UTSW 5 36967015 missense probably damaging 0.99
R2009:Wfs1 UTSW 5 36968309 missense probably damaging 0.96
R2137:Wfs1 UTSW 5 36967501 missense probably damaging 0.99
R2157:Wfs1 UTSW 5 36967942 missense probably damaging 1.00
R2216:Wfs1 UTSW 5 36967220 nonsense probably null
R3779:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3850:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3853:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R3918:Wfs1 UTSW 5 36968624 missense probably benign 0.01
R5056:Wfs1 UTSW 5 36975587 missense probably benign 0.00
R5849:Wfs1 UTSW 5 36973264 missense probably damaging 1.00
R5997:Wfs1 UTSW 5 36967750 missense probably damaging 0.99
R6666:Wfs1 UTSW 5 36967619 missense possibly damaging 0.94
R7024:Wfs1 UTSW 5 36966950 missense probably damaging 1.00
R7157:Wfs1 UTSW 5 36967172 missense probably benign 0.00
R7264:Wfs1 UTSW 5 36967846 missense probably damaging 1.00
R7269:Wfs1 UTSW 5 36967790 nonsense probably null
R7365:Wfs1 UTSW 5 36967732 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTGGACGTGTTACCAGAGCTAC -3'
(R):5'- AGGCCAACTTCTCAGTGATGG -3'

Sequencing Primer
(F):5'- CGTGTTACCAGAGCTACAAGATG -3'
(R):5'- AGAGCTCCATGGTGAAGCTCATTC -3'
Posted On2015-05-15