Mutagenetix > Incidental Mutation

Incidental Mutation 'R4093:Tbx3'

317719

Institutional Source

Beutler Lab

Gene Symbol

Tbx3

Ensembl Gene

ENSMUSG00000018604

Gene Name

T-box 3

Synonyms

D5Ertd189e

MMRRC Submission

041627-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4093 (G1)

Quality Score

152

Status

Validated

Chromosome

Chromosomal Location

119670669-119684724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119680748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 463 (S463T)

Ref Sequence

ENSEMBL: ENSMUSP00000112519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018748] [ENSMUST00000079719] [ENSMUST00000121021]

AlphaFold

P70324

Predicted Effect

probably benign
Transcript: ENSMUST00000018748
AA Change: S483T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018748
Gene: ENSMUSG00000018604
AA Change: S483T

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	310	6.4e-125	SMART
Pfam:TBX	323	411	8.8e-29	PFAM
low complexity region	492	510	N/A	INTRINSIC
low complexity region	524	538	N/A	INTRINSIC
low complexity region	556	576	N/A	INTRINSIC
low complexity region	607	620	N/A	INTRINSIC
low complexity region	662	710	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079719
AA Change: S463T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078657
Gene: ENSMUSG00000018604
AA Change: S463T

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	290	1.01e-127	SMART
Pfam:TBX	303	391	6.5e-29	PFAM
low complexity region	472	490	N/A	INTRINSIC
low complexity region	504	518	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	587	600	N/A	INTRINSIC
low complexity region	642	690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121021
AA Change: S463T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112519
Gene: ENSMUSG00000018604
AA Change: S463T

Domain	Start	End	E-Value	Type
low complexity region	46	63	N/A	INTRINSIC
TBOX	102	290	1.01e-127	SMART
Pfam:TBX	303	391	6.5e-29	PFAM
low complexity region	472	490	N/A	INTRINSIC
low complexity region	504	518	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	587	600	N/A	INTRINSIC
low complexity region	642	690	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154680

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

92% (69/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This protein is a transcriptional repressor and is thought to play a role in the anterior/posterior axis of the tetrapod forelimb. Mutations in this gene cause ulnar-mammary syndrome, affecting limb, apocrine gland, tooth, hair, and genital development. Alternative splicing of this gene results in three transcript variants encoding different isoforms; however, the full length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die are embryonic lethal exhibiting defects in the yolk sac and limb defects. Female embryos show impaired mammary bud induction. Mice homozygous for hypomorphic alleles exhibit varying degrees of prenatal lethality and premature death, heart defects and limb abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	A	G	5: 4,043,996	M2173V	probably damaging	Het
Alas1	G	T	9: 106,241,801		probably null	Het
Angpt1	T	C	15: 42,523,545	T138A	probably damaging	Het
Atp2c2	G	A	8: 119,749,871		probably null	Het
C330027C09Rik	T	C	16: 49,000,976		probably benign	Het
Cadm2	A	G	16: 66,784,788	V210A	possibly damaging	Het
Cfap70	A	T	14: 20,409,113	D671E	probably damaging	Het
Chd2	C	T	7: 73,501,016	E322K	possibly damaging	Het
Chrnd	C	T	1: 87,191,007	Q29*	probably null	Het
Cym	A	G	3: 107,214,266	S237P	probably benign	Het
D030068K23Rik	A	G	8: 109,251,459		noncoding transcript	Het
Gsdma2	T	A	11: 98,650,851	S135T	probably benign	Het
Hc	A	T	2: 34,983,807	Y158*	probably null	Het
Hoxb3	C	A	11: 96,346,100	H335N	probably damaging	Het
Htr2a	G	A	14: 74,706,349	M456I	probably benign	Het
Ighv1-19	G	A	12: 114,708,730	T90I	probably damaging	Het
Kansl3	C	A	1: 36,344,954	S729I	probably damaging	Het
Kcnab1	T	C	3: 65,299,614	I137T	possibly damaging	Het
Kcnt1	A	T	2: 25,877,915	E12V	probably damaging	Het
Klk15	A	T	7: 43,938,780	S171C	possibly damaging	Het
Lcn2	A	T	2: 32,387,716	M1K	probably null	Het
Lrig1	T	C	6: 94,613,578	D487G	probably benign	Het
Lrp8	T	A	4: 107,843,271	C135*	probably null	Het
Lrrc31	C	A	3: 30,695,522	S54I	probably damaging	Het
Ltbp4	A	G	7: 27,325,216	V663A	possibly damaging	Het
Med27	G	A	2: 29,377,908		probably benign	Het
Mical1	T	C	10: 41,486,937		probably benign	Het
Myt1	A	T	2: 181,811,398	M799L	probably damaging	Het
Nlrc4	T	C	17: 74,445,958	M477V	probably benign	Het
Npy4r	T	C	14: 34,147,141	I63M	probably benign	Het
Olfr224	A	T	11: 58,566,829	I172N	probably damaging	Het
Olfr282	T	C	15: 98,437,682	L71P	probably damaging	Het
Olfr672	C	T	7: 104,996,635	G90S	probably benign	Het
Olfr904	T	A	9: 38,464,083	L14Q	probably null	Het
Piezo1	A	C	8: 122,501,160		probably null	Het
Ppp1r12c	T	C	7: 4,483,367	E601G	probably damaging	Het
Proser1	T	C	3: 53,479,712		probably null	Het
Psme2	A	T	14: 55,588,277	N143K	probably benign	Het
Pygo2	C	A	3: 89,433,264	P323Q	probably damaging	Het
Rab11b	T	C	17: 33,749,789	T77A	possibly damaging	Het
Recql5	A	G	11: 115,904,888	S190P	probably benign	Het
Serpina12	A	G	12: 104,037,924	F150L	probably damaging	Het
Sfswap	A	G	5: 129,560,741	S821G	possibly damaging	Het
Slc22a2	C	T	17: 12,612,394	T357M	probably damaging	Het
Spag6l	A	C	16: 16,829,024	N39K	probably benign	Het
Srl	A	G	16: 4,497,452	S109P	possibly damaging	Het
Tagap	A	T	17: 7,929,423	H152L	probably damaging	Het
Tcaf2	A	G	6: 42,642,838	L85P	probably damaging	Het
Tenm4	A	T	7: 96,895,772	S2332C	probably damaging	Het
Trim60	A	T	8: 65,001,378	M73K	probably benign	Het
Trpc1	T	C	9: 95,706,865	T769A	probably benign	Het
Tubgcp4	T	A	2: 121,195,477	L601Q	probably benign	Het
Unc5d	T	C	8: 28,844,837	Y154C	possibly damaging	Het
Vmn1r185	A	T	7: 26,611,783	V99E	probably damaging	Het
Vmn1r57	G	T	7: 5,220,857	S127I	possibly damaging	Het
Vmn1r62	T	A	7: 5,675,944	M208K	probably damaging	Het
Vmn2r110	T	C	17: 20,583,380	D311G	possibly damaging	Het
Vmn2r48	C	A	7: 9,942,258	S432I	probably benign	Het
Vmn2r48	T	A	7: 9,942,259	S432C	probably damaging	Het
Vmn2r71	T	C	7: 85,621,234	V536A	probably benign	Het
Vstm2a	A	G	11: 16,259,884	T37A	probably damaging	Het
Wfs1	T	C	5: 36,967,465	H694R	probably damaging	Het
Zdbf2	T	C	1: 63,309,781	S2440P	possibly damaging	Het
Zfp61	A	G	7: 24,291,275		probably null	Het
Zfp64	T	C	2: 168,925,935	T586A	probably benign	Het
Zfp943	T	A	17: 21,992,982	C350S	probably damaging	Het

Other mutations in Tbx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01960:Tbx3	APN	5	119682643	missense	probably benign	0.45
IGL02174:Tbx3	APN	5	119675584	nonsense	probably null
IGL02508:Tbx3	APN	5	119678812	missense	possibly damaging	0.48
IGL03035:Tbx3	APN	5	119683096	utr 3 prime	probably benign
R0047:Tbx3	UTSW	5	119680446	missense	probably damaging	0.99
R0184:Tbx3	UTSW	5	119675562	missense	probably damaging	1.00
R0365:Tbx3	UTSW	5	119675250	missense	possibly damaging	0.81
R1209:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R1956:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R2231:Tbx3	UTSW	5	119677524	missense	probably damaging	1.00
R4400:Tbx3	UTSW	5	119680571	missense	probably damaging	0.99
R4578:Tbx3	UTSW	5	119682776	missense	probably damaging	0.99
R4693:Tbx3	UTSW	5	119677570	missense	possibly damaging	0.72
R4716:Tbx3	UTSW	5	119675670	missense	possibly damaging	0.94
R4804:Tbx3	UTSW	5	119680512	missense	possibly damaging	0.63
R5664:Tbx3	UTSW	5	119678731	missense	possibly damaging	0.48
R5724:Tbx3	UTSW	5	119675603	missense	possibly damaging	0.75
R5990:Tbx3	UTSW	5	119680529	missense	probably benign	0.02
R6133:Tbx3	UTSW	5	119680953	missense	probably benign	0.19
R6180:Tbx3	UTSW	5	119674067	missense	probably damaging	1.00
R6429:Tbx3	UTSW	5	119674191	nonsense	probably null
R7154:Tbx3	UTSW	5	119672028	missense	possibly damaging	0.89
R7195:Tbx3	UTSW	5	119675583	missense	probably damaging	1.00
R7352:Tbx3	UTSW	5	119677560	missense	probably benign	0.00
R7921:Tbx3	UTSW	5	119680869	missense	possibly damaging	0.76
R7921:Tbx3	UTSW	5	119680870	missense	probably benign	0.01
R8050:Tbx3	UTSW	5	119683067	missense	probably benign	0.38
R8089:Tbx3	UTSW	5	119680569	missense	probably damaging	0.98
R8351:Tbx3	UTSW	5	119680776	missense	probably damaging	1.00
R8422:Tbx3	UTSW	5	119680516	missense	possibly damaging	0.94
R8885:Tbx3	UTSW	5	119680559	missense	probably benign
R8891:Tbx3	UTSW	5	119671918	start gained	probably benign
R8987:Tbx3	UTSW	5	119680821	missense	possibly damaging	0.78
R9240:Tbx3	UTSW	5	119680895	missense	probably benign
X0063:Tbx3	UTSW	5	119680881	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGATTTCCACCACTACGGC -3'
(R):5'- CTGTGGATTCTAGGCCTGAG -3'

Sequencing Primer
(F):5'- ACCACTACGGCCGAGGAG -3'
(R):5'- ATGCTCCGGATACTGTGGC -3'

Posted On

2015-05-15