Incidental Mutation 'R0392:Gm11146'
ID31772
Institutional Source Beutler Lab
Gene Symbol Gm11146
Ensembl Gene ENSMUSG00000079546
Gene Namepredicted gene 11146
Synonyms
MMRRC Submission 038598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0392 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location77588578-77602094 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 77597166 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114231]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068704
SMART Domains Protein: ENSMUSP00000070456
Gene: ENSMUSG00000052450

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083623
Predicted Effect probably benign
Transcript: ENSMUST00000114231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170849
SMART Domains Protein: ENSMUSP00000127794
Gene: ENSMUSG00000090386

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231957
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.6%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik T C 16: 4,977,499 noncoding transcript Het
4930527J03Rik ACCC ACC 1: 178,276,503 noncoding transcript Het
Bcan T A 3: 87,993,562 K455* probably null Het
Casp12 T A 9: 5,348,973 probably benign Het
Ccdc61 T C 7: 18,891,102 M504V probably benign Het
Cd53 A T 3: 106,763,276 V147E probably damaging Het
Cyp2b13 T C 7: 26,085,883 Y226H probably benign Het
Cyp2j7 T C 4: 96,199,434 D413G probably damaging Het
Dcbld1 T C 10: 52,317,134 I254T possibly damaging Het
Ddx39 T G 8: 83,721,737 M206R probably damaging Het
Dgki T A 6: 37,000,178 T666S probably damaging Het
Dnah7a C A 1: 53,504,198 C2271F probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Epha4 T C 1: 77,506,973 K133R probably benign Het
Ift88 A T 14: 57,496,160 probably benign Het
Ighv10-3 A G 12: 114,523,840 probably benign Het
Lamp5 T C 2: 136,060,897 S179P probably damaging Het
Map4 T C 9: 110,078,045 S788P probably damaging Het
Olfr1025-ps1 T A 2: 85,918,762 I279N possibly damaging Het
Otog T C 7: 46,250,075 W267R probably benign Het
Pafah1b2 T C 9: 45,968,853 I175M probably benign Het
Pcdhb12 A G 18: 37,436,958 K386E possibly damaging Het
Pcnt T C 10: 76,384,826 N2056S probably benign Het
Pold2 T C 11: 5,876,776 I53V possibly damaging Het
Rsf1 T A 7: 97,679,005 D1071E probably benign Het
Rtp3 A T 9: 110,989,553 M20K probably damaging Het
S1pr5 T A 9: 21,244,981 I50F probably damaging Het
Slc47a1 A G 11: 61,371,782 S94P probably damaging Het
Slitrk5 G A 14: 111,679,033 V30I probably benign Het
St8sia5 G A 18: 77,254,406 V271M probably damaging Het
Sult2b1 G T 7: 45,733,638 T240N probably damaging Het
Other mutations in Gm11146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gm11146 APN 16 77588610 splice site probably null
R1302:Gm11146 UTSW 16 77602082 missense unknown
R2055:Gm11146 UTSW 16 77595081 intron probably benign
R4843:Gm11146 UTSW 16 77595256 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCATCTCAGGTAAAACGAAAAGGCACAA -3'
(R):5'- GCCAGTAAGCACACATGAAGCCA -3'

Sequencing Primer
(F):5'- GTAAAACGAAAAGGCACAAATGTAG -3'
(R):5'- TGGCCTACACAAATTTTCACC -3'
Posted On2013-04-24