Incidental Mutation 'R4093:Sfswap'
ID317720
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 041627-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4093 (G1)
Quality Score199
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129560741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 821 (S821G)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053737
AA Change: S821G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: S821G

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196287
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGCATCTCAGACTGAG -3'
(R):5'- AAGCCATGTGAGGGTTCCAC -3'

Sequencing Primer
(F):5'- AGGTCTCTTTCACCTCATGCTAGG -3'
(R):5'- CACAGGCATGGACACACTGTG -3'
Posted On2015-05-15