Incidental Mutation 'R4094:Frmd4a'
ID317773
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4094 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4611032 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1031 (Y1031C)
Ref Sequence ENSEMBL: ENSMUSP00000089079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000176828] [ENSMUST00000177457]
Predicted Effect probably benign
Transcript: ENSMUST00000075767
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: Y1031C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: Y1031C

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: Y726C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: Y726C

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177457
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cadm2 A T 16: 66,882,797 N49K probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4591917 intron probably benign
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
R8399:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGACTCATGCATCCTAAC -3'
(R):5'- ACACACAGTGGGTTCGGAAC -3'

Sequencing Primer
(F):5'- CATGCATCCTAACATTCATTCTGTAG -3'
(R):5'- CAGAATGTCTCCTCAGTCAGG -3'
Posted On2015-05-15