Incidental Mutation 'R4094:Ehf'
ID 317778
Institutional Source Beutler Lab
Gene Symbol Ehf
Ensembl Gene ENSMUSG00000012350
Gene Name ets homologous factor
Synonyms 9030625L19Rik
MMRRC Submission 041628-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.711) question?
Stock # R4094 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 103093776-103133620 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 103121095 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090475] [ENSMUST00000111176] [ENSMUST00000125788] [ENSMUST00000140503] [ENSMUST00000151265]
AlphaFold O70273
Predicted Effect probably benign
Transcript: ENSMUST00000090475
SMART Domains Protein: ENSMUSP00000087961
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 206 293 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111176
SMART Domains Protein: ENSMUSP00000106807
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
ETS 183 270 1.84e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125788
SMART Domains Protein: ENSMUSP00000121103
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 42 126 1.39e-35 SMART
PDB:3JTG|A 215 242 1e-8 PDB
Blast:ETS 217 242 1e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128546
Predicted Effect unknown
Transcript: ENSMUST00000140503
AA Change: I25M
SMART Domains Protein: ENSMUSP00000114979
Gene: ENSMUSG00000012350
AA Change: I25M

DomainStartEndE-ValueType
SAM_PNT 70 154 1.39e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151265
SMART Domains Protein: ENSMUSP00000118275
Gene: ENSMUSG00000012350

DomainStartEndE-ValueType
SAM_PNT 31 115 1.39e-35 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to an ETS transcription factor subfamily characterized by epithelial-specific expression (ESEs). The encoded protein acts as a transcriptional repressor and may be involved in epithelial differentiation and carcinogenesis. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,071,192 (GRCm39) C1500R probably damaging Het
Amz1 A T 5: 140,737,921 (GRCm39) M93L probably damaging Het
Asb18 A T 1: 89,942,147 (GRCm39) N51K probably damaging Het
Bcl11b G T 12: 107,883,094 (GRCm39) P335Q probably damaging Het
Bsn A C 9: 107,991,069 (GRCm39) V1561G probably damaging Het
Cadm2 A T 16: 66,679,685 (GRCm39) N49K probably damaging Het
Cct8 T G 16: 87,284,516 (GRCm39) I283L possibly damaging Het
Cdc25b A G 2: 131,031,037 (GRCm39) M121V probably benign Het
Cpne4 A G 9: 104,563,734 (GRCm39) D37G probably damaging Het
Cym A G 3: 107,121,582 (GRCm39) S237P probably benign Het
Dhx35 T A 2: 158,684,276 (GRCm39) I517N probably damaging Het
Erp29 A G 5: 121,590,345 (GRCm39) probably benign Het
Fgd6 C A 10: 93,879,296 (GRCm39) P50Q probably damaging Het
Fhip1b T C 7: 105,037,425 (GRCm39) D386G probably damaging Het
Foxn3 G T 12: 99,162,700 (GRCm39) D400E probably damaging Het
Frmd4a A G 2: 4,615,843 (GRCm39) Y1031C probably damaging Het
Gna13 T A 11: 109,287,242 (GRCm39) I355N probably damaging Het
Hgs T A 11: 120,359,859 (GRCm39) L21* probably null Het
Htr2a G A 14: 74,943,789 (GRCm39) M456I probably benign Het
Itga2 T C 13: 115,007,161 (GRCm39) D389G probably benign Het
Kdm1b T C 13: 47,216,496 (GRCm39) C289R probably damaging Het
Kdm4c T A 4: 74,229,915 (GRCm39) D237E probably benign Het
Lilrb4b A T 10: 51,357,506 (GRCm39) E114V probably damaging Het
Loxl1 G A 9: 58,219,739 (GRCm39) T144I probably damaging Het
Macf1 C T 4: 123,353,062 (GRCm39) R1784Q probably benign Het
Maml2 G A 9: 13,531,449 (GRCm39) S221N probably benign Het
Map3k1 A G 13: 111,892,696 (GRCm39) M853T possibly damaging Het
Micu3 T G 8: 40,788,929 (GRCm39) S147A probably null Het
Nccrp1 T C 7: 28,243,651 (GRCm39) Y261C possibly damaging Het
Or51aa5 T A 7: 103,167,244 (GRCm39) I116F possibly damaging Het
Or5m5 A G 2: 85,814,562 (GRCm39) Y126C probably damaging Het
Or8k18 T C 2: 86,085,674 (GRCm39) D121G probably damaging Het
Or8s10 T C 15: 98,335,563 (GRCm39) L71P probably damaging Het
Pclo C A 5: 14,905,659 (GRCm39) T4963N unknown Het
Pdxk T C 10: 78,300,644 (GRCm39) H13R probably damaging Het
Plcg1 A G 2: 160,589,761 (GRCm39) E95G probably damaging Het
Ppargc1a T C 5: 51,647,406 (GRCm39) N276S possibly damaging Het
Prr12 A G 7: 44,697,371 (GRCm39) L848P unknown Het
Ptcd2 A G 13: 99,468,957 (GRCm39) I202T probably damaging Het
Rab27a A C 9: 72,982,826 (GRCm39) I44L probably damaging Het
Rbfox2 A T 15: 77,016,925 (GRCm39) S82T probably damaging Het
Rsbn1 T A 3: 103,835,974 (GRCm39) F337L probably damaging Het
Samd8 T C 14: 21,843,113 (GRCm39) I414T probably damaging Het
Sema3e A G 5: 14,283,704 (GRCm39) I478V probably benign Het
Sfswap A G 5: 129,637,805 (GRCm39) S821G possibly damaging Het
Slc2a3 A T 6: 122,712,527 (GRCm39) I239N probably benign Het
Spc25 G A 2: 69,032,975 (GRCm39) S50L probably damaging Het
St8sia4 A T 1: 95,555,411 (GRCm39) S206R possibly damaging Het
Syngr3 G A 17: 24,908,817 (GRCm39) probably benign Het
Tigd4 A G 3: 84,501,947 (GRCm39) D288G probably damaging Het
Trim34b A G 7: 103,983,795 (GRCm39) M251V probably benign Het
Ttll5 A T 12: 86,003,376 (GRCm39) R214* probably null Het
Ttn T C 2: 76,730,860 (GRCm39) probably benign Het
Vmp1 A G 11: 86,534,406 (GRCm39) I167T probably benign Het
Zfp64 T C 2: 168,767,855 (GRCm39) T586A probably benign Het
Zfp943 T A 17: 22,211,963 (GRCm39) C350S probably damaging Het
Zscan4f A T 7: 11,135,185 (GRCm39) N197I probably damaging Het
Other mutations in Ehf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Ehf APN 2 103,097,185 (GRCm39) splice site probably null
IGL01296:Ehf APN 2 103,098,500 (GRCm39) splice site probably null
IGL02095:Ehf APN 2 103,097,336 (GRCm39) missense probably damaging 1.00
R0399:Ehf UTSW 2 103,097,215 (GRCm39) missense probably damaging 1.00
R1116:Ehf UTSW 2 103,097,354 (GRCm39) missense probably damaging 1.00
R1728:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R1729:Ehf UTSW 2 103,104,251 (GRCm39) missense possibly damaging 0.51
R2240:Ehf UTSW 2 103,104,420 (GRCm39) missense probably benign
R2287:Ehf UTSW 2 103,097,469 (GRCm39) missense possibly damaging 0.89
R2397:Ehf UTSW 2 103,107,164 (GRCm39) missense probably damaging 0.99
R4687:Ehf UTSW 2 103,097,471 (GRCm39) missense probably damaging 1.00
R4930:Ehf UTSW 2 103,097,202 (GRCm39) missense probably damaging 1.00
R5695:Ehf UTSW 2 103,097,124 (GRCm39) missense probably damaging 1.00
R5925:Ehf UTSW 2 103,097,338 (GRCm39) splice site probably null
R6656:Ehf UTSW 2 103,113,928 (GRCm39) missense probably damaging 1.00
R8217:Ehf UTSW 2 103,109,976 (GRCm39) missense possibly damaging 0.94
R9008:Ehf UTSW 2 103,097,173 (GRCm39) missense
Z1176:Ehf UTSW 2 103,109,863 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCACTGAACTGCCTTGTATC -3'
(R):5'- CAGTTCTGAGGCAGTGTGAG -3'

Sequencing Primer
(F):5'- TGAACTGCCTTGTATCTTTATTAAGC -3'
(R):5'- CTGAGGCAGTGTGAGGAGTG -3'
Posted On 2015-05-15