Incidental Mutation 'R0393:Ubr1'
ID31780
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission 038599-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock #R0393 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120906946 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1039 (Q1039L)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably damaging
Transcript: ENSMUST00000028728
AA Change: Q1039L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: Q1039L

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129790
Meta Mutation Damage Score 0.3813 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,645,878 probably benign Het
Akr1b7 T G 6: 34,415,400 Y49* probably null Het
Ankrd10 G T 8: 11,635,482 R46S possibly damaging Het
Atp13a5 A G 16: 29,266,929 probably benign Het
Baz1a A G 12: 54,918,436 probably null Het
Bicd2 C T 13: 49,379,870 T644M probably damaging Het
Ccr9 A T 9: 123,779,970 H239L probably benign Het
Cd180 A T 13: 102,705,900 N485Y probably damaging Het
Ces1d T A 8: 93,192,772 S131C probably damaging Het
Cnpy2 T A 10: 128,326,207 S116R probably benign Het
Crym T C 7: 120,189,749 K285R probably benign Het
Cyp2a4 A T 7: 26,312,868 I359F possibly damaging Het
Cyp2b10 T A 7: 25,914,934 probably benign Het
Dcpp3 A T 17: 23,917,951 probably benign Het
Dnah8 T A 17: 30,708,390 I1340K probably benign Het
Fbln1 T C 15: 85,227,076 C144R probably damaging Het
Gm1553 T C 10: 82,492,176 R66G unknown Het
Il10rb G A 16: 91,412,010 V103I probably benign Het
Irak1bp1 T A 9: 82,846,561 W182R probably benign Het
Kcna3 T C 3: 107,036,999 S193P probably damaging Het
Kif14 C T 1: 136,482,418 H628Y probably damaging Het
Krt31 A G 11: 100,050,253 L77P probably damaging Het
Krt36 C T 11: 100,104,114 A211T possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lmo7 A G 14: 101,900,456 T743A probably benign Het
Lyst C T 13: 13,647,079 T1346M probably benign Het
Mapkbp1 T A 2: 120,012,903 probably null Het
Mif T C 10: 75,859,804 D55G probably benign Het
Mlh3 G T 12: 85,267,587 C608* probably null Het
Mlip A T 9: 77,239,577 C85S probably benign Het
Mug1 T C 6: 121,849,850 S211P possibly damaging Het
Mybl2 T A 2: 163,061,608 probably benign Het
Myh8 C T 11: 67,306,017 probably benign Het
Nanos1 A G 19: 60,756,930 Y222C probably damaging Het
Olfr1113 A T 2: 87,213,693 Y267F probably benign Het
Olfr1155 T C 2: 87,943,565 D21G possibly damaging Het
Olfr138 G T 17: 38,274,883 M37I probably benign Het
Papolb A G 5: 142,529,456 V144A probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Plod1 A T 4: 147,918,841 L509Q probably null Het
Ppp1r13b C A 12: 111,835,688 M290I probably benign Het
Ralb G C 1: 119,478,126 probably null Het
Slc4a8 T A 15: 100,774,638 D18E probably damaging Het
Speg A C 1: 75,423,924 H2576P possibly damaging Het
Spock1 T C 13: 57,440,536 D241G probably damaging Het
Tcam1 T A 11: 106,284,214 V165E probably benign Het
Thbs1 T A 2: 118,112,991 V30E possibly damaging Het
Tll2 A G 19: 41,088,826 Y834H possibly damaging Het
Tmem5 T C 10: 122,095,936 probably benign Het
Trpm6 G A 19: 18,778,644 D84N probably damaging Het
Ubr4 A G 4: 139,410,860 probably benign Het
Vmn1r74 T C 7: 11,847,315 Y181H possibly damaging Het
Vmn2r13 T C 5: 109,156,529 T679A probably benign Het
Vmn2r91 A T 17: 18,105,450 Y110F probably damaging Het
Zbtb40 A C 4: 137,018,531 S64A probably benign Het
Zfp184 T A 13: 21,947,082 probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
R8856:Ubr1 UTSW 2 120904042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- agcaagccgacaaaaGAAAAGCTAGTATAA -3'
(R):5'- catctcaccagcccAAGACCCT -3'

Sequencing Primer
(F):5'- GCATAAAAATGATGGGTTAGATTCTG -3'
(R):5'- atgtagtagccctctttatctgtc -3'
Posted On2013-04-24