Incidental Mutation 'R4094:Cadm2'
ID 317827
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Name cell adhesion molecule 2
Synonyms A830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2
MMRRC Submission 041628-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock # R4094 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 66655421-67620908 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66882797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 49 (N49K)
Ref Sequence ENSEMBL: ENSMUSP00000134554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000123266] [ENSMUST00000128168]
AlphaFold Q8BLQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000114292
AA Change: N58K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: N58K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120594
AA Change: N49K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: N49K

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120898
AA Change: N49K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: N49K

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123266
SMART Domains Protein: ENSMUSP00000123192
Gene: ENSMUSG00000064115

DomainStartEndE-ValueType
Blast:IG_like 19 53 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128168
AA Change: N49K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: N49K

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141282
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,180,366 C1500R probably damaging Het
Amz1 A T 5: 140,752,166 M93L probably damaging Het
Asb18 A T 1: 90,014,425 N51K probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Bsn A C 9: 108,113,870 V1561G probably damaging Het
Cct8 T G 16: 87,487,628 I283L possibly damaging Het
Cdc25b A G 2: 131,189,117 M121V probably benign Het
Cpne4 A G 9: 104,686,535 D37G probably damaging Het
Cym A G 3: 107,214,266 S237P probably benign Het
Dhx35 T A 2: 158,842,356 I517N probably damaging Het
Ehf T C 2: 103,290,750 probably benign Het
Erp29 A G 5: 121,452,282 probably benign Het
Fam160a2 T C 7: 105,388,218 D386G probably damaging Het
Fgd6 C A 10: 94,043,434 P50Q probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Frmd4a A G 2: 4,611,032 Y1031C probably damaging Het
Gna13 T A 11: 109,396,416 I355N probably damaging Het
Hgs T A 11: 120,469,033 L21* probably null Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Itga2 T C 13: 114,870,625 D389G probably benign Het
Kdm1b T C 13: 47,063,020 C289R probably damaging Het
Kdm4c T A 4: 74,311,678 D237E probably benign Het
Lilr4b A T 10: 51,481,410 E114V probably damaging Het
Loxl1 G A 9: 58,312,456 T144I probably damaging Het
Macf1 C T 4: 123,459,269 R1784Q probably benign Het
Maml2 G A 9: 13,620,153 S221N probably benign Het
Map3k1 A G 13: 111,756,162 M853T possibly damaging Het
Micu3 T G 8: 40,335,888 S147A probably null Het
Nccrp1 T C 7: 28,544,226 Y261C possibly damaging Het
Olfr1030 A G 2: 85,984,218 Y126C probably damaging Het
Olfr1049 T C 2: 86,255,330 D121G probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr611 T A 7: 103,518,037 I116F possibly damaging Het
Pclo C A 5: 14,855,645 T4963N unknown Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Plcg1 A G 2: 160,747,841 E95G probably damaging Het
Ppargc1a T C 5: 51,490,064 N276S possibly damaging Het
Prr12 A G 7: 45,047,947 L848P unknown Het
Ptcd2 A G 13: 99,332,449 I202T probably damaging Het
Rab27a A C 9: 73,075,544 I44L probably damaging Het
Rbfox2 A T 15: 77,132,725 S82T probably damaging Het
Rsbn1 T A 3: 103,928,658 F337L probably damaging Het
Samd8 T C 14: 21,793,045 I414T probably damaging Het
Sema3e A G 5: 14,233,690 I478V probably benign Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc2a3 A T 6: 122,735,568 I239N probably benign Het
Spc25 G A 2: 69,202,631 S50L probably damaging Het
St8sia4 A T 1: 95,627,686 S206R possibly damaging Het
Syngr3 G A 17: 24,689,843 probably benign Het
Tigd4 A G 3: 84,594,640 D288G probably damaging Het
Trim34b A G 7: 104,334,588 M251V probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ttn T C 2: 76,900,516 probably benign Het
Vmp1 A G 11: 86,643,580 I167T probably benign Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Zscan4f A T 7: 11,401,258 N197I probably damaging Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66882751 missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66815350 missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66784785 missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66815304 splice site probably null
IGL02029:Cadm2 APN 16 66747296 missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66882882 missense possibly damaging 0.73
IGL02541:Cadm2 APN 16 66882883 critical splice acceptor site probably null
IGL02952:Cadm2 APN 16 66664452 missense probably damaging 0.99
vitro UTSW 16 66882832 nonsense probably null
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0399:Cadm2 UTSW 16 66747339 nonsense probably null
R0883:Cadm2 UTSW 16 66882814 missense probably damaging 1.00
R1035:Cadm2 UTSW 16 66815347 missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66784840 missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66882795 missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66747384 splice site probably benign
R2108:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R2570:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66815441 missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66784788 missense possibly damaging 0.94
R5421:Cadm2 UTSW 16 66771627 nonsense probably null
R5555:Cadm2 UTSW 16 66784815 missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66882841 missense probably benign 0.04
R6188:Cadm2 UTSW 16 66815307 critical splice donor site probably null
R6224:Cadm2 UTSW 16 66664395 missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66784828 missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66812838 missense probably benign 0.02
R7051:Cadm2 UTSW 16 66882879 missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66882832 nonsense probably null
R7322:Cadm2 UTSW 16 66882846 missense probably damaging 1.00
R7792:Cadm2 UTSW 16 66771637 missense probably benign 0.01
R7882:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R8101:Cadm2 UTSW 16 66812842 missense possibly damaging 0.75
R8166:Cadm2 UTSW 16 66953309 missense probably benign 0.01
R8325:Cadm2 UTSW 16 66815450 missense possibly damaging 0.95
R8496:Cadm2 UTSW 16 66664423 missense probably damaging 1.00
R8746:Cadm2 UTSW 16 66784809 missense probably damaging 0.99
R9396:Cadm2 UTSW 16 66747216 missense probably damaging 0.99
X0026:Cadm2 UTSW 16 66663152 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACGCAGCAGCAGTTTAGTAATC -3'
(R):5'- AAATATAATGGTGTGCCTGTAGGG -3'

Sequencing Primer
(F):5'- CGCAGCAGCAGTTTAGTAATCAAAAG -3'
(R):5'- AGGGTGGTCTAATGATTTGAAATTGC -3'
Posted On 2015-05-15