Incidental Mutation 'R4095:Sfswap'
ID317844
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
MMRRC Submission 040858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4095 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129560741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 821 (S821G)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053737
AA Change: S821G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: S821G

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196287
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Meta Mutation Damage Score 0.0758 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 53,139,462 I1220L probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Apba1 A T 19: 23,944,024 Q737L probably benign Het
Arvcf T A 16: 18,401,577 D564E probably damaging Het
Bcl11b G T 12: 107,916,835 P335Q probably damaging Het
Brd9 G A 13: 73,944,799 V302I probably benign Het
Brinp3 C A 1: 146,901,692 H626N possibly damaging Het
C1qc T C 4: 136,890,326 N153S probably benign Het
Casp3 G A 8: 46,634,216 G66D probably damaging Het
Coq7 T G 7: 118,527,478 probably null Het
Dach1 C T 14: 97,901,379 V491M possibly damaging Het
Dda1 A G 8: 71,473,792 T52A possibly damaging Het
Entpd7 A G 19: 43,704,201 Y65C probably damaging Het
Fmnl2 A G 2: 53,101,523 D350G probably damaging Het
Foxn3 G T 12: 99,196,441 D400E probably damaging Het
Gbp2 A G 3: 142,637,449 T576A probably benign Het
Gm15446 T A 5: 109,940,724 probably null Het
Gtf2a1 G T 12: 91,575,637 T57K possibly damaging Het
Hps5 T C 7: 46,775,794 E494G probably benign Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Hydin A G 8: 110,541,547 N2886S probably damaging Het
Ighv2-6-8 T C 12: 113,796,153 Y112C probably damaging Het
Kcnf1 A T 12: 17,175,479 L247Q possibly damaging Het
Kndc1 A G 7: 139,937,025 M1606V possibly damaging Het
Krt27 T C 11: 99,345,793 T431A probably benign Het
Lama4 A T 10: 39,097,122 I1562F probably damaging Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp1b G A 2: 41,449,191 T880I probably benign Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Mapt T C 11: 104,310,536 probably null Het
Mpdz A T 4: 81,383,823 V229D possibly damaging Het
Olfr1349 T A 7: 6,515,253 S59C possibly damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr49 T C 14: 54,282,731 T55A probably benign Het
Parm1 T C 5: 91,594,180 S136P probably benign Het
Pcdhgb2 T A 18: 37,690,950 S331R probably benign Het
Pdxk T C 10: 78,464,810 H13R probably damaging Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Rell1 C A 5: 63,968,670 V22L probably benign Het
Sema6c T A 3: 95,173,194 L901Q probably benign Het
Slc22a23 A G 13: 34,305,206 L116P probably damaging Het
Slit1 A T 19: 41,608,486 probably benign Het
Spns1 T C 7: 126,370,786 T481A probably damaging Het
Tmem104 T A 11: 115,243,923 Y427* probably null Het
Tmem74 G A 15: 43,867,282 Q122* probably null Het
Tnpo2 T A 8: 85,038,419 L10Q probably damaging Het
Trav6-2 G T 14: 52,667,815 A98S probably benign Het
Ttll5 A T 12: 85,956,602 R214* probably null Het
Ube2b A C 11: 51,997,827 V39G possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Wnk1 G A 6: 119,948,126 T1459I probably damaging Het
Zc3h7a T C 16: 11,145,235 K754R probably damaging Het
Zfp605 A G 5: 110,127,736 K240R probably damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R3757:Sfswap UTSW 5 129513234 missense probably damaging 1.00
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTACCTCCAAGCTGGTGTC -3'
(R):5'- GCCCTACTGAAGAAAGGGAC -3'

Sequencing Primer
(F):5'- TCTAAAGATGCAGGGCCCATCTG -3'
(R):5'- CCTACTGAAGAAAGGGACTGCAC -3'
Posted On2015-05-15