Incidental Mutation 'R0393:Mug1'
ID31789
Institutional Source Beutler Lab
Gene Symbol Mug1
Ensembl Gene ENSMUSG00000059908
Gene Namemurinoglobulin 1
Synonyms
MMRRC Submission 038599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0393 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121838541-121889057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121849850 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 211 (S211P)
Ref Sequence ENSEMBL: ENSMUSP00000032228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032228
AA Change: S211P

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: S211P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:A2M_N 128 221 5e-21 PFAM
A2M_N_2 449 599 2.55e-41 SMART
A2M 740 830 5.43e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
Pfam:A2M_comp 1012 1268 5.4e-94 PFAM
A2M_recep 1378 1465 4.14e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204943
Meta Mutation Damage Score 0.2089 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,645,878 probably benign Het
Akr1b7 T G 6: 34,415,400 Y49* probably null Het
Ankrd10 G T 8: 11,635,482 R46S possibly damaging Het
Atp13a5 A G 16: 29,266,929 probably benign Het
Baz1a A G 12: 54,918,436 probably null Het
Bicd2 C T 13: 49,379,870 T644M probably damaging Het
Ccr9 A T 9: 123,779,970 H239L probably benign Het
Cd180 A T 13: 102,705,900 N485Y probably damaging Het
Ces1d T A 8: 93,192,772 S131C probably damaging Het
Cnpy2 T A 10: 128,326,207 S116R probably benign Het
Crym T C 7: 120,189,749 K285R probably benign Het
Cyp2a4 A T 7: 26,312,868 I359F possibly damaging Het
Cyp2b10 T A 7: 25,914,934 probably benign Het
Dcpp3 A T 17: 23,917,951 probably benign Het
Dnah8 T A 17: 30,708,390 I1340K probably benign Het
Fbln1 T C 15: 85,227,076 C144R probably damaging Het
Gm1553 T C 10: 82,492,176 R66G unknown Het
Il10rb G A 16: 91,412,010 V103I probably benign Het
Irak1bp1 T A 9: 82,846,561 W182R probably benign Het
Kcna3 T C 3: 107,036,999 S193P probably damaging Het
Kif14 C T 1: 136,482,418 H628Y probably damaging Het
Krt31 A G 11: 100,050,253 L77P probably damaging Het
Krt36 C T 11: 100,104,114 A211T possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lmo7 A G 14: 101,900,456 T743A probably benign Het
Lyst C T 13: 13,647,079 T1346M probably benign Het
Mapkbp1 T A 2: 120,012,903 probably null Het
Mif T C 10: 75,859,804 D55G probably benign Het
Mlh3 G T 12: 85,267,587 C608* probably null Het
Mlip A T 9: 77,239,577 C85S probably benign Het
Mybl2 T A 2: 163,061,608 probably benign Het
Myh8 C T 11: 67,306,017 probably benign Het
Nanos1 A G 19: 60,756,930 Y222C probably damaging Het
Olfr1113 A T 2: 87,213,693 Y267F probably benign Het
Olfr1155 T C 2: 87,943,565 D21G possibly damaging Het
Olfr138 G T 17: 38,274,883 M37I probably benign Het
Papolb A G 5: 142,529,456 V144A probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Plod1 A T 4: 147,918,841 L509Q probably null Het
Ppp1r13b C A 12: 111,835,688 M290I probably benign Het
Ralb G C 1: 119,478,126 probably null Het
Slc4a8 T A 15: 100,774,638 D18E probably damaging Het
Speg A C 1: 75,423,924 H2576P possibly damaging Het
Spock1 T C 13: 57,440,536 D241G probably damaging Het
Tcam1 T A 11: 106,284,214 V165E probably benign Het
Thbs1 T A 2: 118,112,991 V30E possibly damaging Het
Tll2 A G 19: 41,088,826 Y834H possibly damaging Het
Tmem5 T C 10: 122,095,936 probably benign Het
Trpm6 G A 19: 18,778,644 D84N probably damaging Het
Ubr1 T A 2: 120,906,946 Q1039L probably damaging Het
Ubr4 A G 4: 139,410,860 probably benign Het
Vmn1r74 T C 7: 11,847,315 Y181H possibly damaging Het
Vmn2r13 T C 5: 109,156,529 T679A probably benign Het
Vmn2r91 A T 17: 18,105,450 Y110F probably damaging Het
Zbtb40 A C 4: 137,018,531 S64A probably benign Het
Zfp184 T A 13: 21,947,082 probably benign Het
Other mutations in Mug1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Mug1 APN 6 121865809 missense probably damaging 1.00
IGL00485:Mug1 APN 6 121887416 missense probably benign 0.17
IGL00816:Mug1 APN 6 121882638 missense probably damaging 0.99
IGL01140:Mug1 APN 6 121882734 missense probably benign 0.01
IGL01141:Mug1 APN 6 121870499 missense probably benign 0.08
IGL01384:Mug1 APN 6 121849474 splice site probably benign
IGL01659:Mug1 APN 6 121870660 splice site probably benign
IGL02049:Mug1 APN 6 121871336 missense probably benign
IGL02151:Mug1 APN 6 121884690 critical splice donor site probably null
IGL02315:Mug1 APN 6 121840167 missense probably benign
IGL02629:Mug1 APN 6 121840065 missense possibly damaging 0.62
IGL02642:Mug1 APN 6 121882585 missense probably benign 0.14
IGL02807:Mug1 APN 6 121886572 missense probably damaging 0.96
IGL02932:Mug1 APN 6 121887427 missense probably benign 0.35
IGL03232:Mug1 APN 6 121878535 missense probably benign 0.00
R1462_Mug1_304 UTSW 6 121882629 missense probably benign 0.41
R2341_Mug1_749 UTSW 6 121884629 missense probably benign 0.06
R4261_Mug1_652 UTSW 6 121873734 missense probably benign
R6173_mug1_139 UTSW 6 121863793 missense probably damaging 0.99
IGL03050:Mug1 UTSW 6 121880571 missense possibly damaging 0.90
R0101:Mug1 UTSW 6 121884247 missense possibly damaging 0.59
R0194:Mug1 UTSW 6 121840107 missense probably damaging 0.98
R0196:Mug1 UTSW 6 121838725 critical splice donor site probably null
R0325:Mug1 UTSW 6 121849842 missense probably benign
R0332:Mug1 UTSW 6 121849897 splice site probably null
R0377:Mug1 UTSW 6 121857361 missense probably benign 0.02
R0414:Mug1 UTSW 6 121856554 missense probably benign 0.00
R0457:Mug1 UTSW 6 121861555 missense probably benign 0.06
R0479:Mug1 UTSW 6 121840227 missense probably benign
R0519:Mug1 UTSW 6 121851424 missense possibly damaging 0.83
R0535:Mug1 UTSW 6 121851454 missense probably benign
R0745:Mug1 UTSW 6 121887427 missense probably benign 0.35
R0939:Mug1 UTSW 6 121884349 missense possibly damaging 0.95
R0975:Mug1 UTSW 6 121878539 missense probably damaging 0.99
R1033:Mug1 UTSW 6 121880551 missense probably damaging 0.99
R1086:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R1116:Mug1 UTSW 6 121870645 missense probably benign
R1131:Mug1 UTSW 6 121861185 missense probably benign 0.18
R1249:Mug1 UTSW 6 121849461 missense probably benign 0.07
R1364:Mug1 UTSW 6 121881713 missense probably damaging 1.00
R1418:Mug1 UTSW 6 121838676 missense probably benign 0.00
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1462:Mug1 UTSW 6 121882629 missense probably benign 0.41
R1494:Mug1 UTSW 6 121879300 missense probably damaging 1.00
R1639:Mug1 UTSW 6 121880571 missense probably damaging 1.00
R1901:Mug1 UTSW 6 121881821 missense probably benign
R1902:Mug1 UTSW 6 121881821 missense probably benign
R2087:Mug1 UTSW 6 121856291 missense probably benign 0.00
R2168:Mug1 UTSW 6 121870499 missense probably benign 0.08
R2249:Mug1 UTSW 6 121870510 missense probably benign
R2341:Mug1 UTSW 6 121884629 missense probably benign 0.06
R2888:Mug1 UTSW 6 121881843 missense probably benign 0.44
R2892:Mug1 UTSW 6 121840070 missense possibly damaging 0.91
R3703:Mug1 UTSW 6 121888556 splice site probably benign
R3789:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3790:Mug1 UTSW 6 121884628 missense probably benign 0.03
R3950:Mug1 UTSW 6 121878530 missense probably damaging 1.00
R4261:Mug1 UTSW 6 121873734 missense probably benign
R4402:Mug1 UTSW 6 121879352 missense probably damaging 1.00
R4589:Mug1 UTSW 6 121857351 missense probably benign 0.19
R4707:Mug1 UTSW 6 121884641 missense probably damaging 1.00
R4766:Mug1 UTSW 6 121884254 missense probably benign 0.01
R4840:Mug1 UTSW 6 121885854 missense probably damaging 1.00
R4984:Mug1 UTSW 6 121838617 utr 5 prime probably benign
R4999:Mug1 UTSW 6 121878943 nonsense probably null
R5198:Mug1 UTSW 6 121874562 missense probably damaging 1.00
R5220:Mug1 UTSW 6 121861133 missense probably benign 0.03
R5253:Mug1 UTSW 6 121888913 missense probably benign 0.03
R5273:Mug1 UTSW 6 121873789 missense probably damaging 0.99
R5285:Mug1 UTSW 6 121841107 missense probably benign 0.45
R5387:Mug1 UTSW 6 121884394 missense probably damaging 0.99
R5560:Mug1 UTSW 6 121861073 missense probably damaging 0.96
R5652:Mug1 UTSW 6 121840181 missense probably benign
R5704:Mug1 UTSW 6 121851433 missense possibly damaging 0.63
R5732:Mug1 UTSW 6 121878493 missense probably benign 0.00
R6053:Mug1 UTSW 6 121865738 missense probably benign 0.00
R6173:Mug1 UTSW 6 121863793 missense probably damaging 0.99
R6578:Mug1 UTSW 6 121887452 missense probably benign 0.00
R6647:Mug1 UTSW 6 121840241 missense probably benign 0.02
R6681:Mug1 UTSW 6 121838724 missense possibly damaging 0.75
R6925:Mug1 UTSW 6 121881787 missense probably damaging 1.00
R7014:Mug1 UTSW 6 121861125 missense probably benign 0.22
R7031:Mug1 UTSW 6 121838714 missense probably benign 0.00
R7034:Mug1 UTSW 6 121873644 missense probably benign 0.00
R7156:Mug1 UTSW 6 121880905 missense probably damaging 1.00
R7156:Mug1 UTSW 6 121884343 missense probably damaging 1.00
R7179:Mug1 UTSW 6 121857420 missense probably benign 0.00
R7211:Mug1 UTSW 6 121880539 missense possibly damaging 0.52
R7318:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7462:Mug1 UTSW 6 121875440 missense probably benign 0.00
R7479:Mug1 UTSW 6 121878508 missense possibly damaging 0.83
R7588:Mug1 UTSW 6 121875517 missense probably damaging 1.00
R7611:Mug1 UTSW 6 121875428 critical splice acceptor site probably null
R7659:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7660:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7661:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7663:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7664:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7666:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7788:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7789:Mug1 UTSW 6 121861220 missense possibly damaging 0.95
R7794:Mug1 UTSW 6 121856288 missense possibly damaging 0.93
R7809:Mug1 UTSW 6 121878985 missense possibly damaging 0.79
R7836:Mug1 UTSW 6 121870652 critical splice donor site probably null
R7867:Mug1 UTSW 6 121873634 missense probably benign
R7904:Mug1 UTSW 6 121851465 missense probably benign
R7937:Mug1 UTSW 6 121861169 missense probably benign 0.00
R7981:Mug1 UTSW 6 121881764 missense probably damaging 1.00
R7999:Mug1 UTSW 6 121880896 missense possibly damaging 0.90
R8070:Mug1 UTSW 6 121875879 missense probably benign 0.26
R8071:Mug1 UTSW 6 121873672 missense probably benign
R8151:Mug1 UTSW 6 121841158 missense probably benign 0.01
R8491:Mug1 UTSW 6 121882729 missense probably damaging 1.00
R8714:Mug1 UTSW 6 121882722 missense probably benign 0.01
R8734:Mug1 UTSW 6 121871381 missense probably benign 0.00
R8807:Mug1 UTSW 6 121874475 missense probably benign 0.27
R8931:Mug1 UTSW 6 121884337 missense probably benign
R8940:Mug1 UTSW 6 121881683 missense
RF017:Mug1 UTSW 6 121884574 missense probably damaging 1.00
X0064:Mug1 UTSW 6 121861215 missense possibly damaging 0.48
Z1176:Mug1 UTSW 6 121841294 missense probably benign 0.32
Z1176:Mug1 UTSW 6 121880493 missense probably damaging 1.00
Z1177:Mug1 UTSW 6 121863808 missense probably damaging 0.99
Z1177:Mug1 UTSW 6 121879299 critical splice acceptor site probably null
Z1177:Mug1 UTSW 6 121886568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAACTGCTATGGGTCAGCAGCC -3'
(R):5'- GTCATCACTCTCTGCCCAGAAATGG -3'

Sequencing Primer
(F):5'- CCCCATATGAGATAACTGGCTTG -3'
(R):5'- TTGCTTCTGAAAAATCCCAGAAC -3'
Posted On2013-04-24