Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Gabrb1'

317915

Institutional Source

Beutler Lab

Gene Symbol

Gabrb1

Ensembl Gene

ENSMUSG00000029212

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit beta 1

Synonyms

Gabrb-1, B230208N19Rik

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71658113-72149037 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71700336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 43 (R43Q)

Ref Sequence

ENSEMBL: ENSMUSP00000031122 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031122] [ENSMUST00000199967]

AlphaFold

P50571

Predicted Effect

probably benign
Transcript: ENSMUST00000031122
AA Change: R43Q

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: R43Q

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	37	243	7.1e-52	PFAM
Pfam:Neur_chan_memb	250	469	2.4e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199398

Predicted Effect

probably benign
Transcript: ENSMUST00000199967
AA Change: R10Q

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000143682
Gene: ENSMUSG00000029212
AA Change: R10Q

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	4	210	4.8e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Gabrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00770:Gabrb1	APN	5	72108446	critical splice donor site	probably null
IGL00774:Gabrb1	APN	5	72108446	critical splice donor site	probably null
IGL01534:Gabrb1	APN	5	71869429	missense	possibly damaging	0.95
IGL02170:Gabrb1	APN	5	72136730	missense	probably damaging	1.00
IGL02326:Gabrb1	APN	5	71700847	missense	probably damaging	0.99
IGL03278:Gabrb1	APN	5	71869596	missense	probably damaging	1.00
IGL03345:Gabrb1	APN	5	72136565	missense	possibly damaging	0.53
IGL03050:Gabrb1	UTSW	5	72122154	missense	probably benign	0.03
PIT4445001:Gabrb1	UTSW	5	72108782	missense	probably damaging	1.00
PIT4515001:Gabrb1	UTSW	5	71700817	missense	probably damaging	1.00
R0109:Gabrb1	UTSW	5	72121946	splice site	probably benign
R0386:Gabrb1	UTSW	5	72108807	missense	probably damaging	0.99
R1512:Gabrb1	UTSW	5	72108704	missense	probably damaging	1.00
R1512:Gabrb1	UTSW	5	72108705	missense	probably damaging	1.00
R1717:Gabrb1	UTSW	5	72108351	splice site	probably null
R1832:Gabrb1	UTSW	5	72121938	splice site	probably null
R2363:Gabrb1	UTSW	5	71869573	nonsense	probably null
R4686:Gabrb1	UTSW	5	71700022	missense	possibly damaging	0.53
R4840:Gabrb1	UTSW	5	71700811	missense	probably damaging	1.00
R4916:Gabrb1	UTSW	5	71869421	missense	probably damaging	1.00
R4941:Gabrb1	UTSW	5	72136778	missense	probably damaging	1.00
R5250:Gabrb1	UTSW	5	71869579	missense	possibly damaging	0.80
R5270:Gabrb1	UTSW	5	72108326	missense	probably damaging	1.00
R5364:Gabrb1	UTSW	5	72136762	missense	probably benign	0.33
R5407:Gabrb1	UTSW	5	72122021	missense	possibly damaging	0.90
R5621:Gabrb1	UTSW	5	72108728	missense	probably damaging	1.00
R5790:Gabrb1	UTSW	5	72136484	missense	possibly damaging	0.53
R6236:Gabrb1	UTSW	5	72108320	missense	probably damaging	1.00
R6336:Gabrb1	UTSW	5	72029898	missense	possibly damaging	0.72
R7411:Gabrb1	UTSW	5	72122195	critical splice donor site	probably null
R8375:Gabrb1	UTSW	5	72029829	missense	probably damaging	0.98
R9161:Gabrb1	UTSW	5	72029856	missense	probably damaging	0.98
R9474:Gabrb1	UTSW	5	72108347	missense	probably damaging	1.00
R9621:Gabrb1	UTSW	5	72122020	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TATTTTCCCGTGCCTGCTGG -3'
(R):5'- CTGAGATTGGGGATAGTGCG -3'

Sequencing Primer
(F):5'- CGTGCCTGCTGGATCATGTATC -3'
(R):5'- TGGGGAAGGAGGCATTATAT -3'

Posted On

2015-05-19