Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Grid2'

317919

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

GluRdelta2, tpr, B230104L07Rik

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63255876-64704323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63908893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 91 (L91S)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852]

AlphaFold

Q61625

Predicted Effect

probably damaging
Transcript: ENSMUST00000095852
AA Change: L91S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: L91S

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159561

SMART Domains

Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	2.7e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161105

Meta Mutation Damage Score

0.6255

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64345589	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64533704	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64320196	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64665915	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64063935	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64345666	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64345873	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64345816	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64063904	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64429822	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63909069	missense	possibly damaging	0.94
crawler	UTSW	6	64429694	nonsense	probably null
swagger	UTSW	6	64395279	synonymous	probably benign
R0133:Grid2	UTSW	6	64320132	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64533587	missense	probably benign
R0193:Grid2	UTSW	6	64063953	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64345734	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64666052	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63503435	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64666275	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64429754	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64429684	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64429694	nonsense	probably null
R1762:Grid2	UTSW	6	64533654	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63909061	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63908918	nonsense	probably null
R2138:Grid2	UTSW	6	64345798	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63503399	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64320021	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64345842	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63503433	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63909045	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64320102	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64665915	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64666201	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63908988	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64429740	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64320152	nonsense	probably null
R5091:Grid2	UTSW	6	64076878	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63256933	missense	probably benign	0.15
R5128:Grid2	UTSW	6	64665998	missense	probably benign	0.01
R5386:Grid2	UTSW	6	63931105	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63930910	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63503361	missense	probably benign
R5626:Grid2	UTSW	6	64076945	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63908991	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64094432	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64663162	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64345593	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63931047	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63931015	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64395299	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64076909	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64700418	missense	unknown
R7126:Grid2	UTSW	6	64076810	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64275870	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64076941	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63931101	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64320136	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63908907	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63256945	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63256933	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64533651	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63503337	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63256939	missense	probably benign
R8965:Grid2	UTSW	6	64320006	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64666155	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63908904	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64700522	missense	unknown
R9653:Grid2	UTSW	6	63930984	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	63908879	missense	possibly damaging	0.76
Z1176:Grid2	UTSW	6	64663228	missense	probably benign	0.03
Z1177:Grid2	UTSW	6	64345856	nonsense	probably null
Z1177:Grid2	UTSW	6	64345857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCCAAAAGAAGCTTGCAC -3'
(R):5'- CATTCAAGTAGACAGGTGGACG -3'

Sequencing Primer
(F):5'- GCTTGCACAACACCACGGAG -3'
(R):5'- TTCAAGTAGACAGGTGGACGAACTG -3'

Posted On

2015-05-19