Incidental Mutation 'R1961:Wnk1'
ID 317924
Institutional Source Beutler Lab
Gene Symbol Wnk1
Ensembl Gene ENSMUSG00000045962
Gene Name WNK lysine deficient protein kinase 1
Synonyms Prkwnk1, 6430573H23Rik, EG406236, Hsn2
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 119900930-120015633 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119946208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 648 (I648M)
Ref Sequence ENSEMBL: ENSMUSP00000145304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060043] [ENSMUST00000088644] [ENSMUST00000088646] [ENSMUST00000177761] [ENSMUST00000203030]
AlphaFold P83741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035513
Predicted Effect probably damaging
Transcript: ENSMUST00000060043
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063001
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.5e-44 PFAM
Pfam:Pkinase 221 479 4.4e-58 PFAM
Pfam:OSR1_C 500 537 2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 865 876 N/A INTRINSIC
low complexity region 1018 1028 N/A INTRINSIC
low complexity region 1042 1058 N/A INTRINSIC
internal_repeat_1 1136 1178 2.15e-5 PROSPERO
low complexity region 1289 1305 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1398 1428 N/A INTRINSIC
low complexity region 1429 1454 N/A INTRINSIC
low complexity region 1496 1515 N/A INTRINSIC
low complexity region 1542 1556 N/A INTRINSIC
low complexity region 1586 1609 N/A INTRINSIC
low complexity region 1670 1691 N/A INTRINSIC
low complexity region 1698 1712 N/A INTRINSIC
low complexity region 1738 1764 N/A INTRINSIC
low complexity region 1882 1900 N/A INTRINSIC
coiled coil region 2065 2092 N/A INTRINSIC
low complexity region 2103 2114 N/A INTRINSIC
low complexity region 2116 2140 N/A INTRINSIC
low complexity region 2208 2232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088644
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086017
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 5.5e-44 PFAM
Pfam:Pkinase 221 479 4.3e-56 PFAM
Pfam:OSR1_C 500 537 1.9e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
low complexity region 1067 1076 N/A INTRINSIC
low complexity region 1146 1158 N/A INTRINSIC
low complexity region 1276 1286 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
internal_repeat_1 1394 1436 2.19e-5 PROSPERO
low complexity region 1547 1563 N/A INTRINSIC
low complexity region 1603 1615 N/A INTRINSIC
low complexity region 1637 1654 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
low complexity region 1687 1712 N/A INTRINSIC
low complexity region 1754 1773 N/A INTRINSIC
low complexity region 1800 1814 N/A INTRINSIC
low complexity region 1844 1867 N/A INTRINSIC
low complexity region 1928 1949 N/A INTRINSIC
low complexity region 1956 1970 N/A INTRINSIC
low complexity region 1996 2022 N/A INTRINSIC
low complexity region 2140 2158 N/A INTRINSIC
coiled coil region 2323 2350 N/A INTRINSIC
low complexity region 2361 2372 N/A INTRINSIC
low complexity region 2374 2398 N/A INTRINSIC
low complexity region 2466 2490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088646
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086019
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.3e-44 PFAM
Pfam:Pkinase 221 479 4e-58 PFAM
Pfam:OSR1_C 500 537 1.8e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 864 874 N/A INTRINSIC
low complexity region 888 904 N/A INTRINSIC
internal_repeat_1 982 1024 7.56e-6 PROSPERO
low complexity region 1135 1151 N/A INTRINSIC
low complexity region 1191 1203 N/A INTRINSIC
low complexity region 1225 1242 N/A INTRINSIC
low complexity region 1244 1274 N/A INTRINSIC
low complexity region 1275 1300 N/A INTRINSIC
low complexity region 1342 1361 N/A INTRINSIC
low complexity region 1388 1402 N/A INTRINSIC
low complexity region 1432 1455 N/A INTRINSIC
low complexity region 1516 1537 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1584 1610 N/A INTRINSIC
low complexity region 1700 1718 N/A INTRINSIC
coiled coil region 1883 1910 N/A INTRINSIC
low complexity region 1921 1932 N/A INTRINSIC
low complexity region 1934 1958 N/A INTRINSIC
low complexity region 2026 2050 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160769
Predicted Effect unknown
Transcript: ENSMUST00000161048
AA Change: I236M
SMART Domains Protein: ENSMUSP00000125345
Gene: ENSMUSG00000045962
AA Change: I236M

DomainStartEndE-ValueType
Blast:S_TKc 2 68 3e-34 BLAST
SCOP:d1phk__ 3 70 2e-7 SMART
Pfam:OSR1_C 89 126 9.5e-21 PFAM
coiled coil region 151 185 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161392
Predicted Effect probably damaging
Transcript: ENSMUST00000177761
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136777
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 1.7e-44 PFAM
Pfam:Pkinase 221 479 5.1e-58 PFAM
Pfam:OSR1_C 500 537 2.2e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 710 722 N/A INTRINSIC
low complexity region 828 839 N/A INTRINSIC
low complexity region 1005 1021 N/A INTRINSIC
low complexity region 1136 1149 N/A INTRINSIC
low complexity region 1153 1162 N/A INTRINSIC
low complexity region 1232 1244 N/A INTRINSIC
low complexity region 1291 1307 N/A INTRINSIC
internal_repeat_1 1385 1427 1.91e-5 PROSPERO
low complexity region 1538 1554 N/A INTRINSIC
low complexity region 1594 1606 N/A INTRINSIC
low complexity region 1628 1645 N/A INTRINSIC
low complexity region 1647 1677 N/A INTRINSIC
low complexity region 1678 1703 N/A INTRINSIC
low complexity region 1745 1764 N/A INTRINSIC
low complexity region 1791 1805 N/A INTRINSIC
low complexity region 1835 1858 N/A INTRINSIC
low complexity region 1919 1940 N/A INTRINSIC
low complexity region 1947 1961 N/A INTRINSIC
low complexity region 1987 2013 N/A INTRINSIC
low complexity region 2131 2149 N/A INTRINSIC
coiled coil region 2314 2341 N/A INTRINSIC
low complexity region 2352 2363 N/A INTRINSIC
low complexity region 2365 2389 N/A INTRINSIC
low complexity region 2457 2481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203030
AA Change: I648M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145304
Gene: ENSMUSG00000045962
AA Change: I648M

DomainStartEndE-ValueType
low complexity region 101 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
Pfam:Pkinase_Tyr 221 477 4.1e-44 PFAM
Pfam:Pkinase 221 479 3.2e-56 PFAM
Pfam:OSR1_C 500 537 1.5e-22 PFAM
coiled coil region 563 597 N/A INTRINSIC
low complexity region 734 746 N/A INTRINSIC
low complexity region 793 809 N/A INTRINSIC
internal_repeat_1 887 929 5.8e-6 PROSPERO
low complexity region 1040 1056 N/A INTRINSIC
low complexity region 1096 1108 N/A INTRINSIC
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1149 1179 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1247 1266 N/A INTRINSIC
low complexity region 1293 1307 N/A INTRINSIC
low complexity region 1337 1360 N/A INTRINSIC
low complexity region 1421 1442 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1489 1515 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
coiled coil region 1816 1843 N/A INTRINSIC
low complexity region 1854 1865 N/A INTRINSIC
low complexity region 1867 1891 N/A INTRINSIC
low complexity region 1959 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162368
SMART Domains Protein: ENSMUSP00000125383
Gene: ENSMUSG00000045962

DomainStartEndE-ValueType
low complexity region 83 95 N/A INTRINSIC
low complexity region 142 158 N/A INTRINSIC
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK subfamily of serine/threonine protein kinases. The encoded protein may be a key regulator of blood pressure by controlling the transport of sodium and chloride ions. Mutations in this gene have been associated with pseudohypoaldosteronism type II and hereditary sensory neuropathy type II. Alternatively spliced transcript variants encoding different isoforms have been described but the full-length nature of all of them has yet to be determined.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die before birth, whereas heterozygotes survive and exhibit decreased blood pressure. Mice homozygous for an allele that does not produce the kidney isoform exhibit a slight increase in systemic arterial diastolic blood pressure and reduced sensitivity to amiloride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Acsm4 T C 7: 119,307,963 (GRCm39) Y367H probably benign Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm39) probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb G A 18: 61,194,577 (GRCm39) R118H possibly damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Sema4a C T 3: 88,345,483 (GRCm39) probably benign Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Other mutations in Wnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Wnk1 APN 6 119,937,669 (GRCm39) missense probably damaging 1.00
IGL01364:Wnk1 APN 6 119,914,372 (GRCm39) missense probably damaging 1.00
IGL01715:Wnk1 APN 6 119,925,358 (GRCm39) missense probably damaging 1.00
IGL01951:Wnk1 APN 6 119,940,446 (GRCm39) missense probably damaging 0.99
IGL02043:Wnk1 APN 6 119,926,039 (GRCm39) unclassified probably benign
IGL02268:Wnk1 APN 6 119,914,334 (GRCm39) nonsense probably null
IGL02348:Wnk1 APN 6 119,940,289 (GRCm39) missense probably damaging 0.98
IGL02425:Wnk1 APN 6 119,940,415 (GRCm39) missense probably damaging 1.00
IGL02850:Wnk1 APN 6 119,914,823 (GRCm39) missense probably benign 0.26
IGL03160:Wnk1 APN 6 119,903,594 (GRCm39) missense probably damaging 1.00
IGL03387:Wnk1 APN 6 119,931,148 (GRCm39) missense possibly damaging 0.76
IGL03405:Wnk1 APN 6 119,930,856 (GRCm39) missense probably benign 0.41
Actor UTSW 6 119,947,939 (GRCm39) missense probably damaging 1.00
Bad UTSW 6 119,942,639 (GRCm39) intron probably benign
Blink UTSW 6 119,979,234 (GRCm39) nonsense probably null
Knock UTSW 6 119,920,839 (GRCm39) splice site probably null
Narrow UTSW 6 119,969,369 (GRCm39) missense probably damaging 1.00
nictitate UTSW 6 119,979,241 (GRCm39) missense possibly damaging 0.88
opportunity UTSW 6 119,928,029 (GRCm39) missense probably damaging 1.00
path UTSW 6 120,014,110 (GRCm39) missense probably damaging 0.99
Stormy UTSW 6 119,969,408 (GRCm39) missense probably damaging 1.00
tear UTSW 6 119,940,431 (GRCm39) missense probably damaging 0.98
Tic UTSW 6 119,927,044 (GRCm39) missense probably damaging 1.00
Unforgiving UTSW 6 119,925,243 (GRCm39) missense probably damaging 1.00
Window UTSW 6 119,969,414 (GRCm39) missense probably damaging 1.00
Woke UTSW 6 119,939,916 (GRCm39) missense probably benign 0.12
IGL03052:Wnk1 UTSW 6 119,921,760 (GRCm39) splice site probably benign
PIT4480001:Wnk1 UTSW 6 119,940,328 (GRCm39) nonsense probably null
R0044:Wnk1 UTSW 6 120,014,110 (GRCm39) missense probably damaging 0.99
R0207:Wnk1 UTSW 6 119,929,694 (GRCm39) missense probably damaging 1.00
R0333:Wnk1 UTSW 6 119,905,124 (GRCm39) intron probably benign
R0453:Wnk1 UTSW 6 119,940,112 (GRCm39) missense probably damaging 0.99
R0457:Wnk1 UTSW 6 119,946,293 (GRCm39) missense probably damaging 1.00
R0501:Wnk1 UTSW 6 119,939,764 (GRCm39) missense probably damaging 1.00
R0525:Wnk1 UTSW 6 119,903,525 (GRCm39) missense probably damaging 1.00
R0526:Wnk1 UTSW 6 119,928,953 (GRCm39) missense probably damaging 0.99
R0606:Wnk1 UTSW 6 119,903,644 (GRCm39) missense probably damaging 1.00
R0658:Wnk1 UTSW 6 119,925,466 (GRCm39) missense probably damaging 0.98
R1148:Wnk1 UTSW 6 119,928,967 (GRCm39) splice site probably benign
R1188:Wnk1 UTSW 6 119,925,670 (GRCm39) nonsense probably null
R1245:Wnk1 UTSW 6 119,925,418 (GRCm39) missense probably benign 0.26
R1449:Wnk1 UTSW 6 119,929,779 (GRCm39) missense probably damaging 1.00
R1469:Wnk1 UTSW 6 119,927,645 (GRCm39) splice site probably benign
R1869:Wnk1 UTSW 6 119,928,050 (GRCm39) missense probably damaging 1.00
R1871:Wnk1 UTSW 6 119,928,050 (GRCm39) missense probably damaging 1.00
R1928:Wnk1 UTSW 6 119,929,884 (GRCm39) missense probably damaging 1.00
R1959:Wnk1 UTSW 6 119,946,208 (GRCm39) missense probably damaging 0.98
R1964:Wnk1 UTSW 6 119,911,343 (GRCm39) missense possibly damaging 0.86
R1983:Wnk1 UTSW 6 119,914,539 (GRCm39) missense probably damaging 1.00
R2062:Wnk1 UTSW 6 119,905,118 (GRCm39) splice site probably null
R2144:Wnk1 UTSW 6 119,925,949 (GRCm39) unclassified probably benign
R2186:Wnk1 UTSW 6 119,925,528 (GRCm39) missense probably benign 0.26
R2281:Wnk1 UTSW 6 119,940,601 (GRCm39) splice site probably null
R2338:Wnk1 UTSW 6 119,946,495 (GRCm39) missense probably benign 0.42
R2420:Wnk1 UTSW 6 119,913,328 (GRCm39) critical splice donor site probably null
R3727:Wnk1 UTSW 6 119,969,414 (GRCm39) missense probably damaging 1.00
R3773:Wnk1 UTSW 6 119,979,241 (GRCm39) missense possibly damaging 0.88
R3836:Wnk1 UTSW 6 119,927,004 (GRCm39) missense probably damaging 1.00
R3837:Wnk1 UTSW 6 119,927,004 (GRCm39) missense probably damaging 1.00
R3847:Wnk1 UTSW 6 119,946,315 (GRCm39) missense possibly damaging 0.70
R3903:Wnk1 UTSW 6 119,926,012 (GRCm39) missense probably damaging 1.00
R4031:Wnk1 UTSW 6 119,928,029 (GRCm39) missense probably damaging 1.00
R4095:Wnk1 UTSW 6 119,925,087 (GRCm39) missense probably damaging 1.00
R4232:Wnk1 UTSW 6 119,926,222 (GRCm39) missense possibly damaging 0.90
R4422:Wnk1 UTSW 6 119,930,856 (GRCm39) missense probably benign 0.41
R4423:Wnk1 UTSW 6 119,903,387 (GRCm39) missense probably damaging 1.00
R4572:Wnk1 UTSW 6 119,928,872 (GRCm39) missense possibly damaging 0.49
R4704:Wnk1 UTSW 6 119,942,705 (GRCm39) missense possibly damaging 0.83
R4755:Wnk1 UTSW 6 119,940,431 (GRCm39) missense probably damaging 0.98
R4812:Wnk1 UTSW 6 119,929,732 (GRCm39) missense probably benign 0.16
R4822:Wnk1 UTSW 6 119,939,399 (GRCm39) missense probably benign 0.02
R4879:Wnk1 UTSW 6 119,926,338 (GRCm39) missense probably damaging 1.00
R4970:Wnk1 UTSW 6 119,942,696 (GRCm39) intron probably benign
R5002:Wnk1 UTSW 6 119,914,924 (GRCm39) missense probably benign 0.13
R5037:Wnk1 UTSW 6 119,942,696 (GRCm39) intron probably benign
R5152:Wnk1 UTSW 6 119,979,241 (GRCm39) missense possibly damaging 0.88
R5257:Wnk1 UTSW 6 120,014,149 (GRCm39) missense probably benign 0.00
R5354:Wnk1 UTSW 6 119,945,484 (GRCm39) missense probably benign 0.01
R5421:Wnk1 UTSW 6 119,929,779 (GRCm39) missense probably damaging 1.00
R5564:Wnk1 UTSW 6 119,925,852 (GRCm39) unclassified probably benign
R5600:Wnk1 UTSW 6 119,926,319 (GRCm39) missense probably damaging 1.00
R5847:Wnk1 UTSW 6 119,969,369 (GRCm39) missense probably damaging 1.00
R6083:Wnk1 UTSW 6 120,014,562 (GRCm39) missense probably damaging 0.99
R6110:Wnk1 UTSW 6 119,949,958 (GRCm39) intron probably benign
R6128:Wnk1 UTSW 6 119,940,747 (GRCm39) splice site probably null
R6237:Wnk1 UTSW 6 119,929,728 (GRCm39) missense probably damaging 1.00
R6341:Wnk1 UTSW 6 119,925,546 (GRCm39) missense probably damaging 1.00
R6467:Wnk1 UTSW 6 119,939,916 (GRCm39) missense probably benign 0.12
R6696:Wnk1 UTSW 6 119,925,243 (GRCm39) missense probably damaging 1.00
R6888:Wnk1 UTSW 6 119,925,742 (GRCm39) missense probably benign 0.26
R6923:Wnk1 UTSW 6 119,942,639 (GRCm39) intron probably benign
R7024:Wnk1 UTSW 6 119,942,687 (GRCm39) intron probably benign
R7072:Wnk1 UTSW 6 119,914,822 (GRCm39) missense unknown
R7087:Wnk1 UTSW 6 120,014,491 (GRCm39) missense possibly damaging 0.94
R7102:Wnk1 UTSW 6 119,925,268 (GRCm39) missense unknown
R7134:Wnk1 UTSW 6 119,903,389 (GRCm39) missense unknown
R7137:Wnk1 UTSW 6 120,015,173 (GRCm39) unclassified probably benign
R7142:Wnk1 UTSW 6 119,926,240 (GRCm39) missense probably benign 0.09
R7174:Wnk1 UTSW 6 119,947,939 (GRCm39) missense probably damaging 1.00
R7205:Wnk1 UTSW 6 119,920,839 (GRCm39) splice site probably null
R7218:Wnk1 UTSW 6 119,979,234 (GRCm39) nonsense probably null
R7498:Wnk1 UTSW 6 119,904,157 (GRCm39) missense unknown
R7599:Wnk1 UTSW 6 119,906,789 (GRCm39) missense possibly damaging 0.83
R7615:Wnk1 UTSW 6 119,909,699 (GRCm39) missense probably benign 0.27
R7799:Wnk1 UTSW 6 119,926,137 (GRCm39) missense probably benign 0.04
R7979:Wnk1 UTSW 6 120,014,409 (GRCm39) missense probably damaging 1.00
R8075:Wnk1 UTSW 6 119,909,675 (GRCm39) missense probably damaging 0.99
R8331:Wnk1 UTSW 6 119,930,794 (GRCm39) missense probably benign 0.09
R8343:Wnk1 UTSW 6 119,940,454 (GRCm39) missense probably damaging 0.99
R8348:Wnk1 UTSW 6 119,906,960 (GRCm39) splice site probably null
R8359:Wnk1 UTSW 6 119,969,408 (GRCm39) missense probably damaging 1.00
R8424:Wnk1 UTSW 6 119,911,388 (GRCm39) missense unknown
R8519:Wnk1 UTSW 6 119,927,044 (GRCm39) missense probably damaging 1.00
R8930:Wnk1 UTSW 6 119,940,226 (GRCm39) missense probably damaging 0.99
R8932:Wnk1 UTSW 6 119,940,226 (GRCm39) missense probably damaging 0.99
R8933:Wnk1 UTSW 6 120,013,959 (GRCm39) missense probably damaging 1.00
R9005:Wnk1 UTSW 6 119,939,393 (GRCm39) missense probably damaging 1.00
R9147:Wnk1 UTSW 6 119,925,631 (GRCm39) missense unknown
R9148:Wnk1 UTSW 6 119,925,631 (GRCm39) missense unknown
R9354:Wnk1 UTSW 6 119,942,660 (GRCm39) missense unknown
R9379:Wnk1 UTSW 6 119,928,678 (GRCm39) missense probably damaging 1.00
X0064:Wnk1 UTSW 6 120,013,993 (GRCm39) missense possibly damaging 0.93
Z1177:Wnk1 UTSW 6 119,925,166 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TACCCTGTGGAGACCTATGTG -3'
(R):5'- GCAGTTTCAAACAGCAGAATGAAC -3'

Sequencing Primer
(F):5'- CCCTGTGGAGACCTATGTGTACTTG -3'
(R):5'- TGAACAACAAGCAAGCGTTTC -3'
Posted On 2015-05-19