Incidental Mutation 'R1961:Acsm4'
ID 317934
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Name acyl-CoA synthetase medium-chain family member 4
Synonyms OMACS, O-MACS
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119289249-119313788 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119307963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 367 (Y367H)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
AlphaFold Q80W40
Predicted Effect probably benign
Transcript: ENSMUST00000047045
AA Change: Y367H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: Y367H

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm39) probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb G A 18: 61,194,577 (GRCm39) R118H possibly damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Sema4a C T 3: 88,345,483 (GRCm39) probably benign Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119,310,642 (GRCm39) nonsense probably null
IGL01676:Acsm4 APN 7 119,307,866 (GRCm39) missense probably benign 0.00
IGL01801:Acsm4 APN 7 119,306,486 (GRCm39) missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119,293,075 (GRCm39) splice site probably null
IGL02220:Acsm4 APN 7 119,310,395 (GRCm39) missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119,309,907 (GRCm39) missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119,302,646 (GRCm39) splice site probably benign
I0000:Acsm4 UTSW 7 119,310,415 (GRCm39) missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119,297,798 (GRCm39) missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119,307,933 (GRCm39) missense probably benign 0.00
R1386:Acsm4 UTSW 7 119,297,801 (GRCm39) missense probably benign
R1433:Acsm4 UTSW 7 119,293,042 (GRCm39) missense probably damaging 0.99
R3957:Acsm4 UTSW 7 119,302,588 (GRCm39) missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119,293,008 (GRCm39) missense probably benign
R4072:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4075:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4076:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4432:Acsm4 UTSW 7 119,310,610 (GRCm39) missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119,297,797 (GRCm39) missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119,297,900 (GRCm39) missense probably benign
R4992:Acsm4 UTSW 7 119,310,640 (GRCm39) missense probably benign 0.43
R5046:Acsm4 UTSW 7 119,302,597 (GRCm39) missense probably damaging 0.99
R5473:Acsm4 UTSW 7 119,312,173 (GRCm39) missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119,294,023 (GRCm39) missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119,293,068 (GRCm39) missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119,310,622 (GRCm39) missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119,292,933 (GRCm39) missense probably benign 0.01
R7892:Acsm4 UTSW 7 119,293,889 (GRCm39) missense possibly damaging 0.48
R8716:Acsm4 UTSW 7 119,307,883 (GRCm39) missense probably damaging 1.00
R8738:Acsm4 UTSW 7 119,304,264 (GRCm39) missense probably benign 0.00
R9616:Acsm4 UTSW 7 119,293,872 (GRCm39) missense probably benign 0.01
Z1177:Acsm4 UTSW 7 119,310,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTCTTGTTTGAACATCTGAAC -3'
(R):5'- AGTGCTCAATCCAAGGGCTG -3'

Sequencing Primer
(F):5'- CTGAACTTGTGATGAAATGCCCC -3'
(R):5'- GTGCTCAATCCAAGGGCTGAATATC -3'
Posted On 2015-05-19