Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Otoa'

317935

Institutional Source

Beutler Lab

Gene Symbol

Otoa

Ensembl Gene

ENSMUSG00000034990

Gene Name

otoancorin

Synonyms

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121081650-121163097 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121118569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 336 (D336E)

Ref Sequence

ENSEMBL: ENSMUSP00000044177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]

AlphaFold

Q8K561

Predicted Effect

probably benign
Transcript: ENSMUST00000047025
AA Change: D336E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: D336E

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163275
AA Change: M18K

Predicted Effect

unknown
Transcript: ENSMUST00000165409
AA Change: M19K

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Otoa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Otoa	APN	7	121155273	critical splice donor site	probably null
IGL01791:Otoa	APN	7	121155849	missense	probably benign	0.25
IGL01924:Otoa	APN	7	121105968	missense	probably damaging	0.99
IGL01953:Otoa	APN	7	121160325	splice site	probably null
IGL02121:Otoa	APN	7	121122024	missense	probably benign	0.06
IGL02303:Otoa	APN	7	121132924	critical splice donor site	probably null
IGL02390:Otoa	APN	7	121131367	missense	possibly damaging	0.84
IGL02591:Otoa	APN	7	121155830	missense	probably damaging	1.00
IGL02811:Otoa	APN	7	121118655	missense	possibly damaging	0.60
IGL02878:Otoa	APN	7	121143853	missense	probably damaging	1.00
IGL03328:Otoa	APN	7	121110994	missense	probably damaging	0.98
R0056:Otoa	UTSW	7	121131347	missense	probably benign	0.00
R0279:Otoa	UTSW	7	121111079	splice site	probably benign
R0390:Otoa	UTSW	7	121131341	missense	probably benign	0.07
R0411:Otoa	UTSW	7	121156527	critical splice donor site	probably null
R0628:Otoa	UTSW	7	121145650	splice site	probably benign
R1113:Otoa	UTSW	7	121125443	nonsense	probably null
R1240:Otoa	UTSW	7	121156490	missense	probably benign
R1308:Otoa	UTSW	7	121125443	nonsense	probably null
R1692:Otoa	UTSW	7	121091551	missense	probably damaging	0.99
R1728:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1729:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1744:Otoa	UTSW	7	121127776	splice site	probably benign
R1759:Otoa	UTSW	7	121134103	missense	probably damaging	1.00
R1784:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1817:Otoa	UTSW	7	121160530	utr 3 prime	probably benign
R2061:Otoa	UTSW	7	121131328	missense	probably damaging	1.00
R2509:Otoa	UTSW	7	121160472	missense	probably benign
R2510:Otoa	UTSW	7	121160472	missense	probably benign
R3411:Otoa	UTSW	7	121122043	missense	probably damaging	1.00
R3438:Otoa	UTSW	7	121160343	missense	possibly damaging	0.80
R3905:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R3907:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R4613:Otoa	UTSW	7	121145568	missense	probably damaging	1.00
R4751:Otoa	UTSW	7	121132924	critical splice donor site	probably benign
R4896:Otoa	UTSW	7	121102679	missense	probably damaging	1.00
R4932:Otoa	UTSW	7	121155135	missense	probably damaging	0.98
R5224:Otoa	UTSW	7	121139793	missense	probably damaging	0.98
R5235:Otoa	UTSW	7	121156470	missense	probably damaging	1.00
R5595:Otoa	UTSW	7	121121977	missense	probably damaging	1.00
R5891:Otoa	UTSW	7	121132360	splice site	probably null
R5894:Otoa	UTSW	7	121121869	missense	probably damaging	1.00
R5905:Otoa	UTSW	7	121094601	missense	probably damaging	1.00
R5976:Otoa	UTSW	7	121127713	missense	probably benign	0.00
R6464:Otoa	UTSW	7	121102605	missense	probably damaging	1.00
R6761:Otoa	UTSW	7	121121950	missense	probably damaging	1.00
R6770:Otoa	UTSW	7	121145614	missense	probably benign	0.25
R6821:Otoa	UTSW	7	121092847	critical splice donor site	probably null
R6924:Otoa	UTSW	7	121131501	splice site	probably null
R7016:Otoa	UTSW	7	121147766	missense	probably damaging	0.99
R7215:Otoa	UTSW	7	121118572	missense	unknown
R7313:Otoa	UTSW	7	121102542	missense	probably benign	0.42
R7340:Otoa	UTSW	7	121130065	missense	probably benign	0.38
R7443:Otoa	UTSW	7	121132410	missense	probably benign	0.00
R7559:Otoa	UTSW	7	121143926	missense	probably damaging	0.99
R7640:Otoa	UTSW	7	121145626	missense	probably damaging	1.00
R7654:Otoa	UTSW	7	121147700	missense	probably damaging	1.00
R7659:Otoa	UTSW	7	121134044	missense	probably benign	0.01
R8421:Otoa	UTSW	7	121099268	critical splice donor site	probably null
R8799:Otoa	UTSW	7	121092671	missense	possibly damaging	0.56
R8954:Otoa	UTSW	7	121145518	nonsense	probably null
R9099:Otoa	UTSW	7	121139832	missense	probably benign
R9126:Otoa	UTSW	7	121094622	missense	probably damaging	1.00
R9369:Otoa	UTSW	7	121145617	missense	probably benign	0.23
U24488:Otoa	UTSW	7	121118540	critical splice acceptor site	probably null
X0023:Otoa	UTSW	7	121118571	missense	probably benign	0.00
Z1177:Otoa	UTSW	7	121118655	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGCTGATGATCCAGGTAGGTG -3'
(R):5'- AACACACCCATGTTTTGTCTACAC -3'

Sequencing Primer
(F):5'- ATCCAGGTAGGTGGTGCAG -3'
(R):5'- CATCTGCCAGGATTGAAGTGC -3'

Posted On

2015-05-19