Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Gria4'

317941

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.682) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 4519546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

probably benign
Transcript: ENSMUST00000027020

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163309

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212533

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTCTCTCTGGCAAATCCAATCTAAG -3'
(R):5'- GGGCTAGCAAGACCCATTTG -3'

Sequencing Primer
(F):5'- GACACAATCCTGGATACTTCAT -3'
(R):5'- GCAAGTGCCTTTAACCAGTG -3'

Posted On

2015-05-19