Incidental Mutation 'R1961:Gria4'
ID 317941
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Glur-4, spkw1, Gluralpha4, Glur4
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.690) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 4519546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably benign
Transcript: ENSMUST00000027020
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063508
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163309
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212533
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Acsm4 T C 7: 119,307,963 (GRCm39) Y367H probably benign Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb G A 18: 61,194,577 (GRCm39) R118H possibly damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Sema4a C T 3: 88,345,483 (GRCm39) probably benign Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4,472,202 (GRCm39) missense probably damaging 0.98
IGL01451:Gria4 APN 9 4,503,652 (GRCm39) missense probably benign 0.04
IGL01533:Gria4 APN 9 4,502,395 (GRCm39) missense probably damaging 1.00
IGL01994:Gria4 APN 9 4,537,726 (GRCm39) missense probably damaging 1.00
IGL02078:Gria4 APN 9 4,793,878 (GRCm39) missense probably damaging 0.98
IGL02183:Gria4 APN 9 4,502,460 (GRCm39) missense probably damaging 1.00
IGL02351:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4,456,206 (GRCm39) missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4,793,804 (GRCm39) splice site probably benign
IGL03131:Gria4 APN 9 4,432,876 (GRCm39) missense probably damaging 0.96
IGL03148:Gria4 APN 9 4,464,295 (GRCm39) missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4,513,288 (GRCm39) missense probably benign
PIT4812001:Gria4 UTSW 9 4,427,128 (GRCm39) missense probably damaging 1.00
R0018:Gria4 UTSW 9 4,432,843 (GRCm39) missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4,793,840 (GRCm39) missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4,464,372 (GRCm39) missense probably benign 0.32
R0690:Gria4 UTSW 9 4,427,071 (GRCm39) missense probably damaging 1.00
R0992:Gria4 UTSW 9 4,795,238 (GRCm39) missense probably benign
R1517:Gria4 UTSW 9 4,793,865 (GRCm39) missense probably damaging 1.00
R1673:Gria4 UTSW 9 4,537,637 (GRCm39) nonsense probably null
R1713:Gria4 UTSW 9 4,424,448 (GRCm39) missense probably benign 0.20
R2137:Gria4 UTSW 9 4,427,026 (GRCm39) intron probably benign
R2397:Gria4 UTSW 9 4,537,717 (GRCm39) missense probably damaging 1.00
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R2870:Gria4 UTSW 9 4,503,614 (GRCm39) missense probably damaging 0.96
R3014:Gria4 UTSW 9 4,464,294 (GRCm39) missense probably damaging 0.97
R3412:Gria4 UTSW 9 4,513,278 (GRCm39) missense probably benign 0.00
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3732:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3733:Gria4 UTSW 9 4,513,295 (GRCm39) missense probably benign
R3897:Gria4 UTSW 9 4,513,260 (GRCm39) missense probably damaging 1.00
R4404:Gria4 UTSW 9 4,464,489 (GRCm39) splice site probably null
R4457:Gria4 UTSW 9 4,427,074 (GRCm39) missense probably damaging 1.00
R4672:Gria4 UTSW 9 4,664,981 (GRCm39) missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4,464,295 (GRCm39) missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4,472,176 (GRCm39) missense probably benign 0.01
R5109:Gria4 UTSW 9 4,472,168 (GRCm39) missense probably damaging 1.00
R5202:Gria4 UTSW 9 4,424,330 (GRCm39) missense probably benign 0.10
R5828:Gria4 UTSW 9 4,432,832 (GRCm39) missense probably damaging 1.00
R5945:Gria4 UTSW 9 4,456,122 (GRCm39) missense probably damaging 1.00
R5985:Gria4 UTSW 9 4,503,593 (GRCm39) missense probably damaging 0.99
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6036:Gria4 UTSW 9 4,537,646 (GRCm39) missense probably benign 0.00
R6111:Gria4 UTSW 9 4,502,430 (GRCm39) missense probably damaging 1.00
R6190:Gria4 UTSW 9 4,420,199 (GRCm39) missense probably benign
R6280:Gria4 UTSW 9 4,456,072 (GRCm39) missense probably damaging 1.00
R6406:Gria4 UTSW 9 4,427,077 (GRCm39) missense probably damaging 1.00
R6470:Gria4 UTSW 9 4,503,680 (GRCm39) missense probably damaging 1.00
R6485:Gria4 UTSW 9 4,464,249 (GRCm39) missense probably damaging 1.00
R6612:Gria4 UTSW 9 4,472,206 (GRCm39) missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4,793,822 (GRCm39) missense probably damaging 1.00
R7046:Gria4 UTSW 9 4,420,278 (GRCm39) missense probably damaging 0.97
R7210:Gria4 UTSW 9 4,464,135 (GRCm39) missense probably damaging 1.00
R7284:Gria4 UTSW 9 4,472,017 (GRCm39) missense probably damaging 1.00
R7475:Gria4 UTSW 9 4,513,330 (GRCm39) missense probably damaging 1.00
R7501:Gria4 UTSW 9 4,502,436 (GRCm39) missense probably benign 0.01
R7536:Gria4 UTSW 9 4,464,298 (GRCm39) missense probably damaging 1.00
R7604:Gria4 UTSW 9 4,464,315 (GRCm39) missense probably damaging 1.00
R7643:Gria4 UTSW 9 4,793,950 (GRCm39) missense probably benign 0.00
R7669:Gria4 UTSW 9 4,462,029 (GRCm39) missense probably damaging 1.00
R7703:Gria4 UTSW 9 4,503,588 (GRCm39) missense probably benign
R7720:Gria4 UTSW 9 4,464,288 (GRCm39) missense probably damaging 1.00
R7724:Gria4 UTSW 9 4,472,074 (GRCm39) missense probably damaging 1.00
R7909:Gria4 UTSW 9 4,464,450 (GRCm39) missense probably damaging 1.00
R8007:Gria4 UTSW 9 4,503,740 (GRCm39) splice site probably benign
R8044:Gria4 UTSW 9 4,456,216 (GRCm39) missense probably damaging 1.00
R8062:Gria4 UTSW 9 4,480,273 (GRCm39) missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4,502,429 (GRCm39) missense probably benign 0.16
R8212:Gria4 UTSW 9 4,480,242 (GRCm39) missense probably benign
R8478:Gria4 UTSW 9 4,793,882 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,351 (GRCm39) missense probably damaging 1.00
R8699:Gria4 UTSW 9 4,424,347 (GRCm39) missense probably damaging 1.00
R8785:Gria4 UTSW 9 4,795,189 (GRCm39) missense possibly damaging 0.92
R8785:Gria4 UTSW 9 4,456,106 (GRCm39) missense probably damaging 1.00
R8888:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R8895:Gria4 UTSW 9 4,664,951 (GRCm39) missense probably damaging 1.00
R9160:Gria4 UTSW 9 4,424,412 (GRCm39) missense probably damaging 1.00
R9498:Gria4 UTSW 9 4,503,560 (GRCm39) critical splice donor site probably null
R9743:Gria4 UTSW 9 4,464,457 (GRCm39) missense probably damaging 1.00
X0023:Gria4 UTSW 9 4,427,067 (GRCm39) missense probably damaging 1.00
X0065:Gria4 UTSW 9 4,464,340 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCTCTCTGGCAAATCCAATCTAAG -3'
(R):5'- GGGCTAGCAAGACCCATTTG -3'

Sequencing Primer
(F):5'- GACACAATCCTGGATACTTCAT -3'
(R):5'- GCAAGTGCCTTTAACCAGTG -3'
Posted On 2015-05-19