Incidental Mutation 'R1961:Fam162b'
ID 317946
Institutional Source Beutler Lab
Gene Symbol Fam162b
Ensembl Gene ENSMUSG00000019909
Gene Name family with sequence similarity 162, member B
Synonyms 9430073N08Rik
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1961 (G1)
Quality Score 146
Status Validated
Chromosome 10
Chromosomal Location 51585416-51590517 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51590334 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 30 (W30R)
Ref Sequence ENSEMBL: ENSMUSP00000020064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020064]
AlphaFold Q9CX19
Predicted Effect probably benign
Transcript: ENSMUST00000020064
AA Change: W30R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020064
Gene: ENSMUSG00000019909
AA Change: W30R

DomainStartEndE-ValueType
Pfam:DUF1075 15 154 3.8e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 (GRCm38) S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 (GRCm38) H230Q probably benign Het
Abcc1 T C 16: 14,396,393 (GRCm38) Y191H probably damaging Het
Abcc4 C A 14: 118,611,459 (GRCm38) V494L possibly damaging Het
Abcc4 C A 14: 118,611,456 (GRCm38) G495C probably damaging Het
Acsm4 T C 7: 119,708,740 (GRCm38) Y367H probably benign Het
Adam21 A T 12: 81,559,508 (GRCm38) Y493* probably null Het
Add2 T C 6: 86,096,756 (GRCm38) F209S probably damaging Het
Adgre4 T C 17: 55,791,497 (GRCm38) S136P probably benign Het
Aff4 T G 11: 53,372,999 (GRCm38) L282R probably damaging Het
Akt3 A G 1: 177,096,995 (GRCm38) I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 (GRCm38) Y174C probably damaging Het
Atl1 A G 12: 69,953,500 (GRCm38) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm38) V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 (GRCm38) probably null Het
Btrc T G 19: 45,527,343 (GRCm38) I480S probably damaging Het
Cacna1c A T 6: 118,630,322 (GRCm38) I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 (GRCm38) N141K probably benign Het
Ccdc167 T C 17: 29,704,431 (GRCm38) N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 (GRCm38) probably benign Het
Cenpe A G 3: 135,242,493 (GRCm38) E1230G probably damaging Het
Clec12a A C 6: 129,350,481 (GRCm38) T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 (GRCm38) F230I probably damaging Het
Exog A G 9: 119,452,266 (GRCm38) E190G possibly damaging Het
Fam172a C A 13: 77,902,720 (GRCm38) H50N probably benign Het
Fndc3b G A 3: 27,456,451 (GRCm38) Q841* probably null Het
Frzb T A 2: 80,424,601 (GRCm38) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 (GRCm38) probably null Het
Gabrb1 G A 5: 71,700,336 (GRCm38) R43Q probably benign Het
Gm21060 A T 19: 61,297,007 (GRCm38) H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 (GRCm38) noncoding transcript Het
Gm5581 A C 6: 131,168,162 (GRCm38) noncoding transcript Het
Gm9894 T C 13: 67,763,915 (GRCm38) noncoding transcript Het
Gpr15 T A 16: 58,718,007 (GRCm38) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm38) probably benign Het
Grid2 T C 6: 63,908,893 (GRCm38) L91S probably damaging Het
Igsf5 A C 16: 96,378,351 (GRCm38) T215P probably damaging Het
Kif13a G A 13: 46,864,838 (GRCm38) probably benign Het
Kif21a G A 15: 90,970,848 (GRCm38) A703V probably damaging Het
Kif27 T G 13: 58,293,123 (GRCm38) R1159S probably benign Het
Kifc2 T A 15: 76,662,825 (GRCm38) L226H probably damaging Het
Klf10 T C 15: 38,295,996 (GRCm38) H435R probably damaging Het
Masp1 T C 16: 23,452,932 (GRCm38) Y623C probably damaging Het
Megf10 T A 18: 57,212,354 (GRCm38) C118S probably damaging Het
Mical3 A G 6: 120,982,607 (GRCm38) V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 (GRCm38) probably null Het
Mpeg1 G A 19: 12,462,911 (GRCm38) V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 (GRCm38) E553G probably damaging Het
Nmi A T 2: 51,948,620 (GRCm38) S301T probably benign Het
Nr2f2 G T 7: 70,358,155 (GRCm38) T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 (GRCm38) N404S probably damaging Het
Olfr54 T G 11: 51,027,475 (GRCm38) S158A probably benign Het
Olfr594 T C 7: 103,219,997 (GRCm38) V93A probably benign Het
Oplah G A 15: 76,297,464 (GRCm38) T1119I probably damaging Het
Otoa T A 7: 121,118,569 (GRCm38) D336E probably benign Het
Pde4b A G 4: 102,597,460 (GRCm38) E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 (GRCm38) R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 (GRCm38) T256I probably benign Het
Pla2g3 C T 11: 3,490,983 (GRCm38) T316I probably benign Het
Plekhg4 A G 8: 105,381,464 (GRCm38) E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 (GRCm38) probably benign Het
Pot1b A T 17: 55,662,531 (GRCm38) Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 (GRCm38) Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 (GRCm38) probably null Het
Rgl2 T C 17: 33,933,615 (GRCm38) L400P probably damaging Het
Rnf122 A G 8: 31,124,846 (GRCm38) probably benign Het
Scgb1b21 G T 7: 33,527,378 (GRCm38) noncoding transcript Het
Sec63 A T 10: 42,823,886 (GRCm38) K647N probably damaging Het
Sema4a C T 3: 88,438,176 (GRCm38) probably benign Het
Serpinf1 C T 11: 75,416,419 (GRCm38) V31I probably benign Het
Sez6l C T 5: 112,424,615 (GRCm38) probably benign Het
Shank3 T C 15: 89,557,964 (GRCm38) S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 (GRCm38) T166M probably benign Het
Slc22a29 C A 19: 8,169,193 (GRCm38) R415M probably benign Het
Slc38a11 A T 2: 65,330,339 (GRCm38) F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 (GRCm38) N363I probably damaging Het
Slx4ip A G 2: 137,067,681 (GRCm38) T129A probably benign Het
Spop T C 11: 95,491,711 (GRCm38) V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 (GRCm38) D147E probably benign Het
Tnpo1 T C 13: 98,852,932 (GRCm38) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm38) V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 (GRCm38) F45V probably damaging Het
Ttc27 T A 17: 74,780,856 (GRCm38) M472K probably damaging Het
Ttll7 A G 3: 146,915,795 (GRCm38) probably benign Het
Ttn T A 2: 76,798,212 (GRCm38) M14535L possibly damaging Het
Ttn A T 2: 76,721,760 (GRCm38) C22851S probably benign Het
Txlna T C 4: 129,640,262 (GRCm38) T54A probably benign Het
Usp33 T C 3: 152,380,628 (GRCm38) V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 (GRCm38) C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 (GRCm38) M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 (GRCm38) probably null Het
Wnk1 T C 6: 119,969,247 (GRCm38) I648M probably damaging Het
Other mutations in Fam162b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Fam162b APN 10 51,590,294 (GRCm38) missense possibly damaging 0.94
IGL02948:Fam162b APN 10 51,587,296 (GRCm38) missense probably damaging 1.00
R0709:Fam162b UTSW 10 51,587,251 (GRCm38) missense probably damaging 1.00
R1185:Fam162b UTSW 10 51,590,343 (GRCm38) missense probably benign
R1185:Fam162b UTSW 10 51,590,343 (GRCm38) missense probably benign
R1185:Fam162b UTSW 10 51,590,343 (GRCm38) missense probably benign
R1505:Fam162b UTSW 10 51,587,202 (GRCm38) missense probably damaging 1.00
R1735:Fam162b UTSW 10 51,587,211 (GRCm38) missense probably damaging 1.00
R2401:Fam162b UTSW 10 51,587,218 (GRCm38) missense probably damaging 0.99
R6059:Fam162b UTSW 10 51,590,307 (GRCm38) missense probably benign 0.28
R6196:Fam162b UTSW 10 51,587,410 (GRCm38) splice site probably null
R6284:Fam162b UTSW 10 51,585,502 (GRCm38) missense probably damaging 0.99
R6625:Fam162b UTSW 10 51,590,295 (GRCm38) missense probably damaging 1.00
R7324:Fam162b UTSW 10 51,590,186 (GRCm38) splice site probably null
R7380:Fam162b UTSW 10 51,590,476 (GRCm38) start gained probably benign
R8945:Fam162b UTSW 10 51,590,373 (GRCm38) missense probably benign 0.02
R9415:Fam162b UTSW 10 51,590,059 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTCTACAGTGGAAGCAACAG -3'
(R):5'- CCCGAAAATTTCCCTGGGAC -3'

Sequencing Primer
(F):5'- CAGGCAGATCAAGAAGCACATTGC -3'
(R):5'- TGCCCCTAGGAGGTCTGTC -3'
Posted On 2015-05-19