Incidental Mutation 'R1961:Aff4'
ID 317950
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 53372999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 282 (L282R)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945] [ENSMUST00000153821]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: L282R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: L282R

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139054
Predicted Effect unknown
Transcript: ENSMUST00000152616
AA Change: L11R
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470
AA Change: L11R

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153821
SMART Domains Protein: ENSMUSP00000120613
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 2 122 4.1e-60 PFAM
Meta Mutation Damage Score 0.2081 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
R9779:Aff4 UTSW 11 53372907 nonsense probably null
R9796:Aff4 UTSW 11 53411997 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGTGGGCAACATTCAAGTC -3'
(R):5'- TGGATTCATGGTCAATTCCCAAG -3'

Sequencing Primer
(F):5'- GTGGGCAACATTCAAGTCAGTCTTTC -3'
(R):5'- ACAGGTGCAACTCACTGA -3'
Posted On 2015-05-19