Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Kif27'

317958

Institutional Source

Beutler Lab

Gene Symbol

Kif27

Ensembl Gene

ENSMUSG00000060176

Gene Name

kinesin family member 27

Synonyms

4930517I18Rik

MMRRC Submission

039975-MU

Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58287502-58359122 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 58293123 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1159 (R1159S)

Ref Sequence

ENSEMBL: ENSMUSP00000153598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]

AlphaFold

Q7M6Z4

Predicted Effect

probably benign
Transcript: ENSMUST00000043605
AA Change: R1159S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: R1159S

Domain	Start	End	E-Value	Type
KISc	3	349	9.18e-160	SMART
low complexity region	369	385	N/A	INTRINSIC
coiled coil region	386	418	N/A	INTRINSIC
Blast:KISc	486	566	5e-29	BLAST
coiled coil region	710	790	N/A	INTRINSIC
coiled coil region	835	891	N/A	INTRINSIC
coiled coil region	916	972	N/A	INTRINSIC
low complexity region	993	1008	N/A	INTRINSIC
coiled coil region	1010	1078	N/A	INTRINSIC
coiled coil region	1186	1226	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180452

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190479

Predicted Effect

probably benign
Transcript: ENSMUST00000224694

Predicted Effect

probably benign
Transcript: ENSMUST00000225388
AA Change: R1159S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Kif27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Kif27	APN	13	58337604	missense	probably benign
IGL00421:Kif27	APN	13	58343889	missense	probably damaging	1.00
IGL00903:Kif27	APN	13	58344672	missense	possibly damaging	0.69
IGL01024:Kif27	APN	13	58288201	missense	possibly damaging	0.71
IGL01070:Kif27	APN	13	58344093	missense	probably damaging	1.00
IGL01761:Kif27	APN	13	58337645	missense	probably benign
IGL02160:Kif27	APN	13	58325998	missense	probably damaging	1.00
IGL03162:Kif27	APN	13	58311207	missense	probably benign	0.03
P0016:Kif27	UTSW	13	58303452	nonsense	probably null
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0016:Kif27	UTSW	13	58354714	missense	probably damaging	1.00
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0018:Kif27	UTSW	13	58288053	missense	probably benign
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0049:Kif27	UTSW	13	58303564	missense	probably damaging	1.00
R0481:Kif27	UTSW	13	58311264	splice site	probably benign
R0960:Kif27	UTSW	13	58323967	missense	probably damaging	0.99
R1015:Kif27	UTSW	13	58320215	missense	probably damaging	1.00
R1205:Kif27	UTSW	13	58344205	missense	probably benign	0.00
R1478:Kif27	UTSW	13	58303545	missense	probably damaging	0.98
R1789:Kif27	UTSW	13	58344008	missense	probably damaging	1.00
R1959:Kif27	UTSW	13	58293123	missense	probably benign	0.00
R3508:Kif27	UTSW	13	58313212	missense	possibly damaging	0.88
R4168:Kif27	UTSW	13	58345748	missense	probably benign	0.01
R4247:Kif27	UTSW	13	58287917	missense	probably damaging	0.98
R4307:Kif27	UTSW	13	58344123	missense	probably benign	0.00
R4621:Kif27	UTSW	13	58331013	missense	probably benign	0.13
R4660:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4661:Kif27	UTSW	13	58323916	missense	probably damaging	0.99
R4736:Kif27	UTSW	13	58328971	missense	probably benign	0.04
R4770:Kif27	UTSW	13	58344377	missense	probably damaging	1.00
R4853:Kif27	UTSW	13	58311258	missense	probably benign	0.06
R4963:Kif27	UTSW	13	58328994	missense	possibly damaging	0.85
R4998:Kif27	UTSW	13	58293143	missense	probably damaging	0.98
R5134:Kif27	UTSW	13	58291090	missense	possibly damaging	0.80
R5225:Kif27	UTSW	13	58293101	missense	possibly damaging	0.88
R5835:Kif27	UTSW	13	58313146	critical splice donor site	probably null
R5875:Kif27	UTSW	13	58311104	missense	probably benign	0.01
R5929:Kif27	UTSW	13	58343970	missense	probably benign	0.01
R6175:Kif27	UTSW	13	58311237	missense	probably damaging	1.00
R6446:Kif27	UTSW	13	58345716	missense	probably damaging	1.00
R6628:Kif27	UTSW	13	58354797	missense	probably damaging	1.00
R7480:Kif27	UTSW	13	58288211	missense	probably benign	0.34
R8381:Kif27	UTSW	13	58291177	missense	probably benign	0.00
R8815:Kif27	UTSW	13	58329004	missense	probably damaging	0.97
R8993:Kif27	UTSW	13	58326098	missense	possibly damaging	0.93
R9181:Kif27	UTSW	13	58344729	missense	probably damaging	1.00
R9486:Kif27	UTSW	13	58344534	missense	probably damaging	1.00
Z1088:Kif27	UTSW	13	58288033	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGTAAGCATTGACTGTGCAC -3'
(R):5'- CTTCATGTAGTCCAAGAAAACTGGG -3'

Sequencing Primer
(F):5'- CTGTGCACAGCAGAGTAGTGAC -3'
(R):5'- GTCCAAGAAAACTGGGCAATCTATTG -3'

Posted On

2015-05-19