Incidental Mutation 'R1961:Kif27'
ID 317958
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Name kinesin family member 27
Synonyms 4930517I18Rik
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.208) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 58435316-58506936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58440937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1159 (R1159S)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
AlphaFold Q7M6Z4
Predicted Effect probably benign
Transcript: ENSMUST00000043605
AA Change: R1159S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: R1159S

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190479
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably benign
Transcript: ENSMUST00000225388
AA Change: R1159S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Acsm4 T C 7: 119,307,963 (GRCm39) Y367H probably benign Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm39) probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb G A 18: 61,194,577 (GRCm39) R118H possibly damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Sema4a C T 3: 88,345,483 (GRCm39) probably benign Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58,485,418 (GRCm39) missense probably benign
IGL00421:Kif27 APN 13 58,491,703 (GRCm39) missense probably damaging 1.00
IGL00903:Kif27 APN 13 58,492,486 (GRCm39) missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58,436,015 (GRCm39) missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58,491,907 (GRCm39) missense probably damaging 1.00
IGL01761:Kif27 APN 13 58,485,459 (GRCm39) missense probably benign
IGL02160:Kif27 APN 13 58,473,812 (GRCm39) missense probably damaging 1.00
IGL03162:Kif27 APN 13 58,459,021 (GRCm39) missense probably benign 0.03
P0016:Kif27 UTSW 13 58,451,266 (GRCm39) nonsense probably null
R0016:Kif27 UTSW 13 58,502,528 (GRCm39) missense probably damaging 1.00
R0016:Kif27 UTSW 13 58,502,528 (GRCm39) missense probably damaging 1.00
R0018:Kif27 UTSW 13 58,435,867 (GRCm39) missense probably benign
R0018:Kif27 UTSW 13 58,435,867 (GRCm39) missense probably benign
R0049:Kif27 UTSW 13 58,451,378 (GRCm39) missense probably damaging 1.00
R0049:Kif27 UTSW 13 58,451,378 (GRCm39) missense probably damaging 1.00
R0481:Kif27 UTSW 13 58,459,078 (GRCm39) splice site probably benign
R0960:Kif27 UTSW 13 58,471,781 (GRCm39) missense probably damaging 0.99
R1015:Kif27 UTSW 13 58,468,029 (GRCm39) missense probably damaging 1.00
R1205:Kif27 UTSW 13 58,492,019 (GRCm39) missense probably benign 0.00
R1478:Kif27 UTSW 13 58,451,359 (GRCm39) missense probably damaging 0.98
R1789:Kif27 UTSW 13 58,491,822 (GRCm39) missense probably damaging 1.00
R1959:Kif27 UTSW 13 58,440,937 (GRCm39) missense probably benign 0.00
R3508:Kif27 UTSW 13 58,461,026 (GRCm39) missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58,493,562 (GRCm39) missense probably benign 0.01
R4247:Kif27 UTSW 13 58,435,731 (GRCm39) missense probably damaging 0.98
R4307:Kif27 UTSW 13 58,491,937 (GRCm39) missense probably benign 0.00
R4621:Kif27 UTSW 13 58,478,827 (GRCm39) missense probably benign 0.13
R4660:Kif27 UTSW 13 58,471,730 (GRCm39) missense probably damaging 0.99
R4661:Kif27 UTSW 13 58,471,730 (GRCm39) missense probably damaging 0.99
R4736:Kif27 UTSW 13 58,476,785 (GRCm39) missense probably benign 0.04
R4770:Kif27 UTSW 13 58,492,191 (GRCm39) missense probably damaging 1.00
R4853:Kif27 UTSW 13 58,459,072 (GRCm39) missense probably benign 0.06
R4963:Kif27 UTSW 13 58,476,808 (GRCm39) missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58,440,957 (GRCm39) missense probably damaging 0.98
R5134:Kif27 UTSW 13 58,438,904 (GRCm39) missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58,440,915 (GRCm39) missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58,460,960 (GRCm39) critical splice donor site probably null
R5875:Kif27 UTSW 13 58,458,918 (GRCm39) missense probably benign 0.01
R5929:Kif27 UTSW 13 58,491,784 (GRCm39) missense probably benign 0.01
R6175:Kif27 UTSW 13 58,459,051 (GRCm39) missense probably damaging 1.00
R6446:Kif27 UTSW 13 58,493,530 (GRCm39) missense probably damaging 1.00
R6628:Kif27 UTSW 13 58,502,611 (GRCm39) missense probably damaging 1.00
R7480:Kif27 UTSW 13 58,436,025 (GRCm39) missense probably benign 0.34
R8381:Kif27 UTSW 13 58,438,991 (GRCm39) missense probably benign 0.00
R8815:Kif27 UTSW 13 58,476,818 (GRCm39) missense probably damaging 0.97
R8993:Kif27 UTSW 13 58,473,912 (GRCm39) missense possibly damaging 0.93
R9181:Kif27 UTSW 13 58,492,543 (GRCm39) missense probably damaging 1.00
R9486:Kif27 UTSW 13 58,492,348 (GRCm39) missense probably damaging 1.00
Z1088:Kif27 UTSW 13 58,435,847 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGTAAGCATTGACTGTGCAC -3'
(R):5'- CTTCATGTAGTCCAAGAAAACTGGG -3'

Sequencing Primer
(F):5'- CTGTGCACAGCAGAGTAGTGAC -3'
(R):5'- GTCCAAGAAAACTGGGCAATCTATTG -3'
Posted On 2015-05-19