Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Mmrn2'

317963

Institutional Source

Beutler Lab

Gene Symbol

Mmrn2

Ensembl Gene

ENSMUSG00000041445

Gene Name

multimerin 2

Synonyms

Emilin3, EndoGlyx-1, ENDOGLYX1

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.051) question?

Stock #

R1961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34375465-34404287 bp(+) (GRCm38)

Type of Mutation

splice site (547 bp from exon)

DNA Base Change (assembly)

A to G at 34398475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111908]

AlphaFold

A6H6E2

Predicted Effect

probably benign
Transcript: ENSMUST00000111908
AA Change: E434G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445
AA Change: E434G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	55	127	1.1e-15	PFAM
low complexity region	174	186	N/A	INTRINSIC
low complexity region	356	362	N/A	INTRINSIC
coiled coil region	387	480	N/A	INTRINSIC
coiled coil region	533	583	N/A	INTRINSIC
coiled coil region	688	715	N/A	INTRINSIC
Pfam:C1q	821	940	1.5e-27	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000227130

Meta Mutation Damage Score

0.0951

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rgl2	T	C	17: 33,933,615	L400P	probably damaging	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Mmrn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01523:Mmrn2	APN	14	34403217	missense	probably damaging	1.00
IGL02529:Mmrn2	APN	14	34398613	missense	possibly damaging	0.74
IGL02590:Mmrn2	APN	14	34399267	nonsense	probably null
P0037:Mmrn2	UTSW	14	34403065	missense	probably damaging	1.00
R0323:Mmrn2	UTSW	14	34398034	missense	probably damaging	0.97
R0499:Mmrn2	UTSW	14	34397956	missense	probably damaging	1.00
R1073:Mmrn2	UTSW	14	34396294	critical splice donor site	probably null
R1422:Mmrn2	UTSW	14	34396239	missense	probably damaging	1.00
R1455:Mmrn2	UTSW	14	34399132	missense	probably benign	0.00
R1584:Mmrn2	UTSW	14	34375685	missense	probably benign	0.19
R1702:Mmrn2	UTSW	14	34397914	missense	probably benign	0.34
R1919:Mmrn2	UTSW	14	34397643	missense	probably benign	0.10
R2267:Mmrn2	UTSW	14	34399492	missense	probably benign	0.41
R2268:Mmrn2	UTSW	14	34399492	missense	probably benign	0.41
R2516:Mmrn2	UTSW	14	34398802	missense	probably benign	0.12
R2571:Mmrn2	UTSW	14	34402939	missense	probably damaging	0.99
R2696:Mmrn2	UTSW	14	34398415	missense	probably damaging	1.00
R2892:Mmrn2	UTSW	14	34396630	missense	probably benign	0.01
R2919:Mmrn2	UTSW	14	34402922	missense	possibly damaging	0.72
R3611:Mmrn2	UTSW	14	34398675	missense	probably benign	0.00
R3898:Mmrn2	UTSW	14	34399560	splice site	probably null
R3899:Mmrn2	UTSW	14	34399560	splice site	probably null
R3900:Mmrn2	UTSW	14	34399560	splice site	probably null
R4363:Mmrn2	UTSW	14	34397977	missense	probably damaging	0.99
R4392:Mmrn2	UTSW	14	34397616	missense	probably damaging	1.00
R4510:Mmrn2	UTSW	14	34403059	missense	possibly damaging	0.67
R4511:Mmrn2	UTSW	14	34403059	missense	possibly damaging	0.67
R4993:Mmrn2	UTSW	14	34396398	missense	probably damaging	1.00
R5026:Mmrn2	UTSW	14	34399201	missense	probably benign	0.07
R5263:Mmrn2	UTSW	14	34399584	missense	probably benign
R5478:Mmrn2	UTSW	14	34396582	missense	probably benign	0.11
R5606:Mmrn2	UTSW	14	34397624	missense	probably damaging	1.00
R6059:Mmrn2	UTSW	14	34397591	nonsense	probably null
R6279:Mmrn2	UTSW	14	34397657	missense	probably benign
R6300:Mmrn2	UTSW	14	34397657	missense	probably benign
R6938:Mmrn2	UTSW	14	34398714	missense	probably benign	0.22
R7491:Mmrn2	UTSW	14	34399417	missense	probably damaging	1.00
R7607:Mmrn2	UTSW	14	34398940	missense	possibly damaging	0.58
R7979:Mmrn2	UTSW	14	34396181	nonsense	probably null
R7999:Mmrn2	UTSW	14	34397922	missense	probably benign	0.30
R8113:Mmrn2	UTSW	14	34397636	missense	probably benign	0.39
R9063:Mmrn2	UTSW	14	34398610	missense	probably benign	0.04
R9092:Mmrn2	UTSW	14	34396630	missense	probably benign	0.00
R9180:Mmrn2	UTSW	14	34399201	missense	probably benign	0.07
R9327:Mmrn2	UTSW	14	34375516	unclassified	probably benign
R9476:Mmrn2	UTSW	14	34398450	missense	possibly damaging	0.94
R9510:Mmrn2	UTSW	14	34398450	missense	possibly damaging	0.94
R9606:Mmrn2	UTSW	14	34397697	missense	possibly damaging	0.58
X0064:Mmrn2	UTSW	14	34399152	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAGAAACCTCTCTGCTCTGC -3'
(R):5'- TGTGCATGACATCCCTGTG -3'

Sequencing Primer
(F):5'- TGCACATGGTCACTAGCCAGAG -3'
(R):5'- GGCAGTTGCAGTCCTTGACATAC -3'

Posted On

2015-05-19