Incidental Mutation 'R1961:Slitrk1'
ID317965
Institutional Source Beutler Lab
Gene Symbol Slitrk1
Ensembl Gene ENSMUSG00000075478
Gene NameSLIT and NTRK-like family, member 1
Synonyms3200001I04Rik
MMRRC Submission 039975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1961 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location108908800-108914158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108912190 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 363 (N363I)
Ref Sequence ENSEMBL: ENSMUSP00000097897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100322]
Predicted Effect probably damaging
Transcript: ENSMUST00000100322
AA Change: N363I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097897
Gene: ENSMUSG00000075478
AA Change: N363I

DomainStartEndE-ValueType
LRR 81 104 1.37e2 SMART
LRR 105 128 1.37e1 SMART
LRR 129 152 4.57e0 SMART
LRR_TYP 153 176 2.75e-3 SMART
LRR 180 200 1.92e2 SMART
LRRCT 212 262 3.45e-5 SMART
LRRNT 340 376 4.28e0 SMART
LRR 374 397 1.86e1 SMART
LRR 398 421 1.49e1 SMART
LRR 422 445 2.68e1 SMART
LRR 446 469 4.98e-1 SMART
LRR_TYP 470 493 6.52e-5 SMART
LRR 494 517 3.46e2 SMART
LRRCT 529 579 3.91e-4 SMART
transmembrane domain 621 643 N/A INTRINSIC
Meta Mutation Damage Score 0.3320 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. However, the protein encoded by this gene lacks the region of homology to neurotrophin receptors. This protein is thought to be involved in neurite outgrowth. Mutations in this gene may be associated with Tourette syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display hypoactivity, reduced male body weight, elevated anxiety- and depression-like behavior, increased norepinephrine content in brain, and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Slitrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Slitrk1 APN 14 108911837 missense probably damaging 1.00
IGL00949:Slitrk1 APN 14 108911809 missense probably damaging 0.98
IGL01556:Slitrk1 APN 14 108913018 missense probably damaging 1.00
IGL01924:Slitrk1 APN 14 108911239 missense probably benign 0.08
IGL02389:Slitrk1 APN 14 108912322 missense probably benign
IGL02619:Slitrk1 APN 14 108911917 missense probably benign 0.09
IGL02828:Slitrk1 APN 14 108911616 missense possibly damaging 0.63
R0070:Slitrk1 UTSW 14 108913317 start gained probably benign
R0135:Slitrk1 UTSW 14 108911629 missense probably benign 0.00
R0627:Slitrk1 UTSW 14 108912239 missense probably damaging 1.00
R1529:Slitrk1 UTSW 14 108913277 start codon destroyed probably benign 0.33
R1661:Slitrk1 UTSW 14 108911927 missense probably damaging 1.00
R1711:Slitrk1 UTSW 14 108913096 missense probably benign 0.21
R1960:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R4247:Slitrk1 UTSW 14 108912562 missense possibly damaging 0.95
R4394:Slitrk1 UTSW 14 108911303 missense probably benign 0.01
R5027:Slitrk1 UTSW 14 108912308 missense probably benign
R5241:Slitrk1 UTSW 14 108913012 missense probably benign 0.27
R5599:Slitrk1 UTSW 14 108911812 missense probably benign 0.00
R5835:Slitrk1 UTSW 14 108911572 missense possibly damaging 0.94
R6224:Slitrk1 UTSW 14 108912022 missense probably damaging 1.00
R6489:Slitrk1 UTSW 14 108911303 missense possibly damaging 0.63
R6504:Slitrk1 UTSW 14 108911697 missense probably benign 0.14
R7102:Slitrk1 UTSW 14 108912629 missense probably benign 0.01
R7346:Slitrk1 UTSW 14 108913159 missense possibly damaging 0.89
R7413:Slitrk1 UTSW 14 108911925 nonsense probably null
R8005:Slitrk1 UTSW 14 108913265 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAATTTCTCCCGGGACAGAGTG -3'
(R):5'- TGGAGGTACAAAGATCCCGG -3'

Sequencing Primer
(F):5'- CACCTGAGGTCCAAAAGGTTCTTG -3'
(R):5'- GTACAAAGATCCCGGGCAACTG -3'
Posted On2015-05-19