Incidental Mutation 'R1961:Kif21a'
ID317973
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission 039975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1961 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90970848 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 703 (A703V)
Ref Sequence ENSEMBL: ENSMUSP00000104910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
Predicted Effect probably benign
Transcript: ENSMUST00000067205
AA Change: A703V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: A703V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088614
AA Change: A716V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: A716V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100304
AA Change: A716V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: A716V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109287
AA Change: A703V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: A703V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109288
AA Change: A703V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: A703V

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
Meta Mutation Damage Score 0.1955 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0420:Kif21a UTSW 15 90968054 unclassified probably benign
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 intron probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7290:Kif21a UTSW 15 90967229 nonsense probably null
R7438:Kif21a UTSW 15 90993796 missense probably benign 0.37
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
R7891:Kif21a UTSW 15 90956314 missense probably damaging 1.00
R7974:Kif21a UTSW 15 90956314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTAGTCGAGGTACCTTG -3'
(R):5'- GAGTCTCCATCCTTACTCAGGG -3'

Sequencing Primer
(F):5'- AGTCGAGGTACCTTGGTTTTC -3'
(R):5'- TGGAGCCCAAAACCTTAGTCATTAG -3'
Posted On2015-05-19